QIAseq 16S/ITS Screening Panel Primers?
Hello! I'm trying to analyze some metagenomic samples that are a mixture of bacteria and fungi. I used the QIAseq 16S/ITS Screening Panel Kit for library prep, and now I'm looking for the sequence of the 16S and ITS primers from that kit and can't find anything. Does anyone else know where to find that information?
Thank you!
1 answer
From Resources Tab --> Application Note found at --> https://www.qiagen.com/us/products/next-generation-sequencing/metagenomics/targeted-metagenomics/qiaseq-16s-its-region-panel
Sequences for the full-length primers targeting the 16S gene are as follows:
16S PCR Forward Primer
= 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG (CCTACGGGNGGCWGCAG)
16S PCR Reverse Primer
= 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG (GACTACHVGGGTATCTAATCC)
The underlined sequences (shown in paranthesis above) target the V3V4 region of the 16S rRNA gene.
Log in to answer this question.
More posts like this
-
Looking for phytopathogenic, Nitrogen-Fixing, and Growth-Promoting databases for Metagenomic Analys…
written by Christopher •
-
How to detect unknown primer sequence
written by genetixs •
-
Database for taxonomic assignment of shotgun sequencing reads data
written by Muhammad •
-
KRAKEN2 database build ref-seq have some missing data
written by jimmy0958073736 •
-
How to split a FASTQ file with ITS and 16S reads in it in R
written by katie.miaow •
-
has anyone use trimmomatic with NEBNext adaptors
written by eozcan •
-
Tutorial: Principles and Workflow of 16S/18S/ITS Amplicon Sequencing
written by contact •
-
If I have a miRNA purified sample, can I use TruSeq Stranded mRNA LT for library prep?
written by valopes •
-
Metagenomic Mappers & Benchmark Datasets?
written by jnowacki
-
Advice on primer ordering for 16s + ITS sequencing
written by emericklarkin •
Hello! Any luck figuring this out? I am now facing the same situation.