This is a test version of Biostars. For the public version, visit https://www.biostars.org.
has anyone use trimmomatic with NEBNext adaptors

Hello,

I am trying to remove adapters from my RNA-seq files obtained from Illumina. I used NEBNext ultra directional kit for illumina for library prep and NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 1) for adaptors and primers. I want to use trimmomatic, it has adapter files for Truseq already, I wonder if anyone used trimmomatic for cleaning adapters from NEBnext instead? What would be the options? Do I need to write a new fasta file for adapters?

rna-seq

Hello, I have a similar question. Recently we did NGS library preparation for target enrichment of genomic libraries and we used the NEBNext® Multiplex Oligos for Illumina with double indexing.

I read somewhere that NEBnext kits are based on the TruSeq kits and therefore have the same adapters. So when i used fastqc to check the raw data i found some universal Illumina adapter. I trimmed those with the default TruSeq fasta in trimmomatic because i did not know that NEBnext might have additional adapters not recognized by fastqc. Can we say that all adapter sequences have been removed in this case?

Can it be that fastqc does not recognize any additional adapter sequences of NEBnext kit and additional trimming is required? Is the core adapter sequence you are referring to the same as the universal illumina adapter i mentioned above?

Any help would be appreciated.

It is the same.

Many thanks for your help. Do you mean that the NEBnext and Truseq core adapter sequences are the same?

Yes.

2 answers

You can go thorough this previous post to get idea about the fasta file for NEBNext adapters. Universal adapter remains the same, however indexed primer differs according to the index you have used during library preparation. So you can concern the person who has prepared the same and can add that sequence in adapter fasta.

Regarding options to choose in trimmomatic, you can keep them the same as trueseq or can change it based on the Quality check of your data.

Agreed. Adding on this, it is only the core adapter sequence that matters in adapter trimming because it is the part that is sequence first. Once this is trimmed, anything that comes 3' of it is trimmed as well, so the downstream nucleotide sequence has no influence on the trimming.

Create the fasta file NEBNext_PE.fa with the adapters:

>NEBNext_3p
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
>NEBNext_5p
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Then run Trimmomatic by specifying this fasta file /path/to/NEBNext_PE.fa in the ILLUMINACLIP step:

ILLUMINACLIP:/path/to/NEBNext_PE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 

See details of the options in the manual http://www.usadellab.org/cms/uploads/supplementary/Trimmomatic/TrimmomaticManual_V0.32.pdf

Log in to answer this question.