Empty output file after trim primers with Cutadapt
Dear all, I have a problem with Cutadapt. After trimming primers from R1 and R2 fastq files, output fastq file is empty. Only the name of read is conserved. Lines corresponding with quality and DNA sequence are removed on the output fastq file. Primers are placed in 3' end for both R1 and R2 reads and I used the -a option followed by the sequence of primers. Output fastq file is generated by it is incomplete. I tried first merging both reads and then trimming 3' and 5' adapters using -a and -g options, but this problem remain also when using the merge fastq file. Anyone could help me to fix this problem?
Thank you!
• 3,017 views
•
link
0 answers
No answers yet.
Log in to answer this question.
please post the cutadapt command you have used and few example reads from R1 and R2
We used 3 forward and 2 reverse degenerate primers. Following, we detailed all possible primers.
Example of two first R1 reads (fastq file):
Example of two first R2 reads (fastq file):
Example of two first R1 reads after applying Cutadapt
Example of two first R2 reads after applying Cutadapt
Command used for trimming forward primers:
Command used for trimming reverse primers:
Thank you for you support.
Best regards
You are getting the empty reads because you are removing 5' sequences (for each read) as 3' sequences due to which entire read is getting trimmed. Following are the sequences that occur at 5' end for each read, however, you are removing it as 3' sequence (
-uoption in cutadapt).For R1, this primer sequence AGGTGAAGTTAAAGGTTCTTACTTAAA is a problem with current cutadapt command. Rest of the R1 reads in your file are affected by other primer sequences:
For R2, this primer sequence CCTTCTAATTTACCTACAACTG is a problem with current cutadapt command. Rest of the R2 reads in your file are affected by other primer sequences:
Your primer sequences seem to vary only at few positions and I constructed a common sequence (one for forward and one for reverse) as per IUPAC code and used them to trim the reads. Please do a thorough check on the output.
For R1
For R2
Since they are paired end, I would suggest this:
Thank you very much for taking time to check commands and reads. I appreciate your selfless work. Consensus sequence of reverse primer is fine, however, after review consensus sequence of forward primer I believe that AGGTGAARYWAAAGGTTCWTAYTTAAA is more addequate. Following I detailed primer sequences:
Thank you very much for you help!! Best regards
Hopefully, issue is resolved and consensus for R1you posted is correct. If query is addressed, please resolve the post, by accepting the answer.