This is a test version of Biostars. For the public version, visit https://www.biostars.org.
What is the right illumina universal adapter sequence for trimming paired-end reads?

I have paired-end WES reads and FastQC report shows adapter content error “Illumina Universal adaptor”. I read the Adapter_list.txt in the fastQC folder which says that the Illumina universal adapter can be summarized in the 12 bp fragment of AGATCGGAAGAG.

My question is should I use this sequence (AGATCGGAAGAG) for both forward and reverse reads? or I should make a complementary sequence of CTCTTCCGATCT for the reverse read?

cutadapt -a AGATCGGAAGAG -A AGATCGGAAGAG -o tr_R1.fastq -p tr_R2.fastq R1.fastq R2.fastq

or

cutadapt -a AGATCGGAAGAG -A CTCTTCCGATCT -o tr_R1.fastq -p tr_R2.fastq R1.fastq R2.fastq

?

wes fastqc trimadaptor

1 answer

The answer is

cutadapt -a AGATCGGAAGAG -A AGATCGGAAGAG -o tr_R1.fastq -p tr_R2.fastq R1.fastq R2.fastq

You can use the same sequence. I think you should also check the trimming report, read 1 and read 2 should have similar stats.

Thank you for your answer. I have tried both ways and then I see a good fastQC result with either of them! That is why I am not sure if I should just keep the first one or dig into it and find out which one is better.

What would be the good comparison point to decide which one to use?

can you post the fastqc images here?

Does cutadapt remove the sequence you put in and its reverse complement (+ to the end of the read) from every string in the fastq file?

I think it too short to use only 12 nt sequence to trim adapter. fastp gives Illumina universal adapter for both reads, reads 1 is _AGATCGGAAGAGCACACGTCTGAACTCCAGTCA_ and reads 2 is _AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT_

I tried running flexbar with the longer adapters and it didn't remove any of the adapters. fastqc shows same.

Log in to answer this question.