I am writing my first program that uses the SAMtools API, and I am running into an error. I have created a simple example program that isolates the error, which is shown below. Essentially, when I run the program on a .sam file generated by bwa aln and bwa samse, I get a warning message about a missing CIGAR sequence, and then an error message about the sequence and quality being inconsistent.

Is this a problem with my code or with the data?

Here is the stripped-down program....

#include <stdio.h>
#include "sam.h"

int main(int argc, char **argv)
{
  samfile_t *sam = samopen(argv[1], "r", NULL);
  if(sam == NULL)
  {
    fprintf(stderr, "file open error: '%s'\n", argv[1]);
    return 1;
  }

  bam_header_t *header = sam_header_read(sam->x.tamr);
  if(header == NULL)
  {
    fprintf(stderr, "SAM header parse error\n");
    return 1;
  }

  bam1_t *alignment = bam_init1();
  int bytesread;
  while((bytesread = samread(sam, alignment)) > 0)
  {
    if(alignment->core.flag & 4)
    {
      // unmapped; ignore
      continue;
    }

    char *seqid = header->target_name[alignment->core.tid];
    unsigned long left = alignment->core.pos + 1;
    unsigned long right = bam_calend(&alignment->core, bam1_cigar(alignment)) + 1;
    char strand = (alignment->core.flag & 16) ? '+' : '-';
    printf("%s[%lu, %lu]%c\n", seqid, left, right, strand);
  }

  bam_header_destroy(header);
  bam_destroy1(alignment);
  samclose(sam);
  return 0;
}

....the first few lines of the .sam file...

@SQ    SN:chr1    LN:249250621
HWUSI-EAS566_0006:1:1:1018:13259#0    0    chr1    162546618    37    26M    *    0    0    GGCAGGGGACAAGACTCGGCGTTGCA    e\cT\`bbT\]Y`Y^^a^^c]\L_]`    XT:A:U    NM:i:0    X0:i:1    X1:i:0    XM:i:0    XO:i:0    XG:i:0    MD:Z:26
HWUSI-EAS566_0006:1:1:1019:11220#0    4    *    0    0    *    *    0    0    AGAAAGAGCTCATGCAGCGTCTTAAG    ab\a\b^ccacaaaL]]]]Ra^^^^a
HWUSI-EAS566_0006:1:1:1025:16447#0    16    chr1    183604878    25    26M    *    0    0    ACTGATTCCCTTCCCTCTTCCGCTCT    \_Y]\Y^^L^^Xa`a`^_JacL\_b^    XT:A:U    NM:i:2    X0:i:1    X1:i:0    XM:i:2    XO:i:0    XG:i:0    MD:Z:0C7A17
HWUSI-EAS566_0006:1:1:1026:12890#0    4    *    0    0    *    *    0    0    TGGCTAAGAGGGAGTGGGTGTTGCGG    cccc`T]`Y`\\O]Wb\b_b^caLc\
HWUSI-EAS566_0006:1:1:1027:12527#0    4    *    0    0    *    *    0    0    CCTTCTCTCTTCCTCGGCGCTGCCTA    dbd`dad^bda^^b\^acaaY__T\`
HWUSI-EAS566_0006:1:1:1028:10989#0    4    *    0    0    *    *    0    0    AGTTCCGGCGCAGCCGGGATTTGGGT    \ddddccLacddcdadd`[_Y]__]^
HWUSI-EAS566_0006:1:1:1031:18950#0    4    *    0    0    *    *    0    0    GTAATGGCTTCAAGGACTATCAATGC    cdYLccTbcb`^\bTHU]_Qbb\T`\
HWUSI-EAS566_0006:1:1:1037:2137#0    4    *    0    0    *    *    0    0    GGCTTGCTAAGCAGAGGCCGGAAGCG    eYeeea`^bb_\aY\_d_daY^^^^_
HWUSI-EAS566_0006:1:1:1037:19136#0    4    *    0    0    *    *    0    0    ATATCTGCTTCCGACACAGCTGCAAT    aT\YT_Yb_Y\aa``TY`]YT^\Y`a

...and the error that gets generated.

[standage@lappy ~] gcc -Wall -I /path/to/samtools/ -L /path/to/samtools/ -o test test.c -lbam -lz
[standage@lappy ~] ./test test.sam
[samopen] SAM header is present: 1 sequences.
[sam_read1] reference '162546618' is recognized as '*'.
Parse warning at line 2: mapped sequence without CIGAR
Parse error at line 2: sequence and quality are inconsistent
Abort trap: 6
[standage@lappy ~]