This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How To Discard Sequences Longer Than N Nucleotides ?

Hi Everyone,I have some small RNAs data.The length of reads are between 18 to 36. Now,I want to discard sequences longer than 27 nucleotides. How can I do?
There is an example. I have a file named mss.fasta.The contents of the following is the file:

>hb3_563308_x1 
GGGATCGACGGTTCGGTCGGTGC 
>hb8_30401_x1
TCTTTGCACGCCCGTTGCGCCCGCGGCCC
>hb7_268329_x1
GAAGGAGAAATCGTGTCTGAACCA
>hb6_975200_x1
TGATGCTTGCTGTGCCTGCACAGATT
>hb1_2324034_x16
TGTTTTCGGATACTGCCA
>hb2_216320_x1
TGCTAACTAGCTATGCGGAGCCATCCCTCCGCATCT

Now I need the retain the sequence length short than 28.This result of example is that.

>hb3_563308_x1
GGGATCGACGGTTCGGTCGGTGC
>hb7_268329_x1
GAAGGAGAAATCGTGTCTGAACCA
>hb6_975200_x1
TGATGCTTGCTGTGCCTGCACAGATT
>hb1_2324034_x16
TGTTTTCGGATACTGCCA

How can I do ? Thank you very much !

small rna data

Assuming reads are fastq format?

clearly not, after edit :)

7 answers

Using awk for a fastq file:

gunzip -c file.fastq.gz| \
awk '{y= i++ % 4 ; L[y]=$0; if(y==3 && length(L[1])<=27) {printf("%s\n%s\n%s\n%s\n",L[0],L[1],L[2],L[3]);}}'

update: from your example ( a fasta input):

cat input.fa| \
awk '{y= i++ % 2 ; L[y]=$0; if(y==1 && length(L[1])<=27) {printf("%s\n%s\n",L[0],L[1]);}}'

Hi

Thanks for sharing this awk one liner. Could you please explain it abit in detail, I am leaning awk one liners. This command is really awesome!!

'i' is the current number of lines,'y' is the index of the line for the fastq record and is just the modulo of i/4. 'y' can be 0,1,2 or 3. we put all the lines '$0' in an associative array 'L' with 'y' as the key. if y==3, we have reached the end of the record: we print the content 'L' if needed.

I enter the following command.

cat mss.fasta | awk '{y= i++ % 4 ; L[y]=$0; if(y==3 && length(L[1])<=27) {printf("%s\n%s\n%s\n%s\n",L[0],L[1],L[2],L[3]);}}'

,I can't get the result I needed.

because for your example, it's not a FASTQ input but a FASTA, change 4 to 2.

Thank you very much ! I get that.

I have another question .If I want to retain the length between 30 to 33 ,what can I do?

cat input.fa | awk '{y= i++ % 2 ; L[y]=$0; if(y==1 && length(L[1])>=30 && length(L[1])<=33) {printf("%s\n%s\n",L[0],L[1]);}}'

Best to post as new question rather than ask in the comments. In this case though, it would probably be closed for being too similar to the original question. I think you can come up with a solution yourself, based on what people have contributed here.

This is great. I had a need for this function and I wrapped the awk command here into a bash script (Linux). Two scripts, actually. One for fastq, one for fasta. Fastq script handles singe read, paired ends, and keeps 1 or 2 indexes in phase with your filtered output. To help you decide what to filter on, I also wrote two accompanying scripts to generate length histograms of your fastq or fasta file(s). Clone my github repo and add the cloned directory to your path to gain functionality.

The commands you would use are: filter_fastq_by_length.sh, filter_fasta_by_length.sh, fastq_length_histogram.sh, and fasta_length_histogram.sh.

They work great with miseq data, but I might need to change the grep strings to work with hiseq data. Shoot me a note here or github if you run into any issues.

Or, use bioawk, which deals with gzipped files and FASTQ natively. I recommend it more than rolling your own FASTQ parser each time.

For example:

bioawk -cfastx '{if (length($seq) <= 100) {print "@"$name"\n"$seq"\n+\n"$qual}} ' file.fq.gz

Note: this only uses FASTQ names (before the first space); it will discard everything after.

The example above is in fasta format, not fastq.

Intentional; showing readers how to do it in FASTQ allows them to extend it to FASTA. Anyone that can't adapt this to FASTA probably shouldn't be copying and pasting commands from the internet into their shells.

Okay, I just thought you misread it...

I apologize if this is a really basic awk/bioawk question, but if I use this command, do I need to provide a new output name for the file that contains only the <= 100 bp reads, e.g. by adding a > newfile.fq.gz, or, does this command overwrite the file.fq.gz with only the appropriately sized reads? Thanks!

In true "there's more than one way to do it" form, I present perl:

#!/usr/bin/perl

$head;
while (<>){
        if($_ =~ />/){
                $head = $_;
        }elsif(length($_) < 27){
                print "$head" . "$_";
        }
}

I dont really dig oneliners so not sure how to convert it but I'm sure it's pretty easy.

faFilter from the Genome Browser utilities

faFilter -maxSize=27

Do you want to discard them altogether or trim them to 27bp?

git clone https://github.com/lh3/seqtk.git
cd seqtk/
make
./seqtk trimfq -l 27 file.fq > file.trim.fq

Thank you .I need to discard them altogether nor trim them to 27bp.

Using Biopieces:

read_fasta -i in.fna | grab -e 'SEQ_LEN > 30' | write_fasta -o out.fna -x
>hb3_563308_x1 
GGGATCGACGGTTCGGTCGGTGC 
>hb8_30401_x1
TCTTTGCACGCCCGTTGCGCCCGCGGCCC
>hb7_268329_x1
GAAGGAGAAATCGTGTCTGAACCA
>hb6_975200_x1
TGATGCTTGCTGTGCCTGCACAGATT
>hb1_2324034_x16
TGTTTTCGGATACTGCCA
>hb2_216320_x1
TGCTAACTAGCTATGCGGAGCCATCCCTCCGCATCT

#put the above read fasta text into a file named text.txt
#use the following perl script, name it test.pl

#!/usr/bin/perl -w
use strict;
my $id ="";
my %seq;
open IN,"<test.txt";
while(<IN>) {
  chomp;
  if(/^>/) {
    $id = $_;
}
else {
    $seq{$id} = $_;
    }
}
close IN;

foreach my $key (keys %seq) {
    if(length($seq{$key}) <=27) {
        print "$key\n$seq{$key}\n";
    }
}

#run this script by typing in terminal: perl test.pl

This hurts my eyes ;oP: a Perl three liner.

It hurt my eyes because the formatting was really bad. Please, make an effort to format correctly (e.g. indent lines of code with 4 spaces). Answers are auto-previewed as you type, so you can see how it will look.

Log in to answer this question.