I have small rna data to assembly,there is no reference sequence .the length is18-28nt.
The result like the result of cap3 . Like this
>1
ACCTTTTTTTTTTACCCCT
>2
CTTTTTTTTTTACCCCTACAC
Result
>contig1
ACCTTTTTTTTTTACCCCTACAC
which program is better?
•
written
by
2011101101 •
You might want to start by having a look at this pretty exhaustive comparison, which is based on Fonseca et al. (2012) but up-to-date.
Andreas
He says he has no reference genome and your second link points to a paper comparing mapping tools that require a reference. The first link seems to be broken.
One possibility is to do de novo assembly of your very short reads with Pinball:
https://github.com/avilella/pinball/wiki
If you want to skip installation and set up, you can try the virtual machine here:
ftp://ftp.ebi.ac.uk/pub/databases/ensembl/avilella/pinball/PinballVM.1.0.4.ova
The installation procedure of the virtual machine is the same as described here:
http://www.ensembl.org/info/data/virtual_machine.html
Hope it helps.
Log in to answer this question.
You will have to improve this question to get an answer. "Which soft is better" does not make sense. What is "soft"?
your reads are shorter than 28nt?
reads from short rna libraries often contain a very high percentage of adapter sequence, so in case you were running 36bp protocol it's not surprising to end up with 18-28bp soft-trimmed reads
Yes,the clean reads.