Sir can we modify above awk syntax in this way

instead of printing like

>1
>2
....

it prints like

>chromosome1
>chromosome2
...

for that purpose, where and how do I put the text "chromosome"

please help me out

How can we add "chr" just after >? I don't want to change anything else. For example:

2L I want it to become chr2L

Hello there, (I already solved this)

I am trying to understand your script line to modified. So, is the script saying?:

For every line ('/) where you find a > (^>/) print the > and then add (+) a counter (+), then next print what follows.

In my case the names are like:

> M02137:143:000000000-APU54:1:1101:21985:13014 1:N:0:10
> M02137:143:000000000-APU54:1:1112:18691:9995 1:N:0:10

etc.

I want to leave only what is different.

awk '/^>/{print ">" remove "M02137:143:000000000-APU54:1:"; next}{print}' < file.fasta

And can I do this in ssh? ( I don't think I have awk installed)

Many thanks in advance for your time,

Caro

PS: I am new to HTS/NGS and don't know much about programming

This doesn't work if the read spans in multiple lines ?

@Pierre Lindenbaum

Hi,

1. how can I modify this command to add genus_species name after > in every entry and yet keep most of the information in the the header

   ie. my entries are like this

   >lcl|HF546977.1_cds_CCO27433.1_1 [gene=cox1] [protein=cytochrome c oxidase subunit 1] [protein_id=CCO27433.1] [location.......]
   

   and want to have the entries name like this

   >genus_species HF546977.1_cds_CCO27433.1_1 [gene=cox1] [protein=cytochrome c oxidase subunit 1]
   

   By using

   awk '/^>/{print ">genus_species gene." ++i; next}{print}' < file.fa
   

   I got,

   >genus_species gene.1
   

   and so on

2. and how can I add output file in the command line

Having the genus_species name in the beginning is requires as I'll be comparing different species and also, I don't want to loose the ids and protein names for ease of downstream analysis.

Hello Pierre, Thank you for your useful code. May I please ask how can I modify the code to keep everything else in the sequence and just to add the sample name in front and that too for the batch of files.

e.g. my file looks like :

>M03691:51:000000000-BD94Y:1:1101:14841:1381 1:N:0:1

ACTGGGTGTAAAGGGCGTGTAGGCGGAGAAGCAAGTCAGAAGTGAAATCCATGGGCTTAACCCATGAACTGCTTTTGAAACTGTTTCCCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAGTGTAGCGGTGAAATGCGTAGATATTAGGAGGAACACCAGTGGCGAAGGCGGCCTGCTGGACGACAACTGACGCTGAGGCGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCCGGT

M03691:51:000000000-BD94Y:1:1101:15960:1389 1:N:0:1 TACTGGGGTATCTAATCCTATTTGCTCCCCACGCTTTCGGGACTGAGCGTCAGTTATGCGCCAGATCGTCGCCTTCGCCACTGGTGTTCCTCCATATATCTACGCATTTCACCGCTACACATGGAATTCCACGATCCTCTCACACACTCTAGCTCTACGGTTTCCATGGCTTACCGAAGTTAAGCTTCGATCTTTCACCACAGACCCTTAGTGCCGCCTGCTCCCTCTTTACACCCAGT M03691:51:000000000-BD94Y:1:1101:15662:1415 1:N:0:1 ACTGGGTGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCTGCGCCGGGTACGGGCGGGCTGGAGTGCGGTAGGGGAGACTGGAATTCCCGGTGTAACGGTGGAATGTGTAGATATCGGGAAGAACACCAATGGCGAAGGCAGGTCTCTGGGCCGTTACTGACGCTGAGGAGCGAAAGCGTGGGGAGCGAACAGGATTAGATACCCCCGTA

Now I want to add Sample name after > and keep everything else as it it.

This process I want to do for a batch of files. Any help will be really great. Thanks, Mitra

Hello Pierre, when I use awk '/^>/{print ">" ++i; next}{print}' < file.fasta, the changes are made but not saved. I want to distinguish between two numbered contig.fasta files (each fasta is numbered 'contig 00001', 'contig00002' etc, I want to name the 1st contig.fasta 'shorter_contig 00001, 'shorter_contig 00002' and the 2nd.contig.fasta 'longer_contig 00001, 'longer_contig 00002' ) is there a way make the header modifications permanent? Thanks

Hello, i want to change the fasta name of this input file :

M04631:312:000000000-C6V6K:1:2107:11495:1734 1:N:0:ACTGAGCG+TTATGCGA

M04631:312:000000000-C6V6K:1:2107:13059:1785 1:N:0:ACTGAGCG+TTATGCGA

In this fasta name:

adjH001

adjH002

adjH....

adjH099

adjH100

what script do I have to use??