Hi, if i have the following read:
@HWI-ST261:7:1:16113:8289#0/1
.CTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACAAACCCCGACTTCCGGGAGGGGCGCATTTATTAG
+
BWURTY[YYVacaccccccca_ccc\cc_ccccccccac_c_aYVcccc_c_accc_ZccUUUUVYV_c_[ZVV^
Where the 4th row is the score. as far as i understand each base has a probability which is interpreted as the quality, how can I compute the overall sequence read quality and be able to say the quality of the read is >50% for example. i know there several types of scores.
Thanks
2 answers
With just the sequence, you can calculate the number of Q30 or Q20 bases -- the number of bases with scores greater than 30 and 20 respectively. So you could say X% of the bases have a quality score greater than 20. Once you have done the mapping, then you'll also get a mapping quality which is a single value that indicates the quality of the mapping.
The overall quality score can be calculated with the average of the individual base scores (in this case is Phred+64 scale), but this average only represents how "good" is your read and can be biased if the Illumina's pipeline used "chastity" (you will see a run of B's close to the end).
To understand the scale, please check: http://en.wikipedia.org/wiki/Phred_quality_score and http://en.wikipedia.org/wiki/FASTQ_format
Log in to answer this question.
-
Fastq-Dump Quality Scores Off Scale
written by Clare
-
Bwa Run With Fastq File With Different Read Length
written by ttom
-
Calculating Coordinates Of Split Rna-Seq Reads Converted From Bam To Bed
written by Alex Reynolds
-
Problem With Picard Dedup In Illumina Alignment Pipeline
written by tommivat
-
Gatk Realignertargetcreator Sam/Bam Header Error
written by Houkto •
-
Picard Exception: "Multiple Samrecord With Read Name..."
written by Pavel Senin
-
Parsing Fastq Files
written by deepthitheresa •
-
Cut The Reads Of A Paired End Fastq File
written by Empyrean •
-
Trim The Low-Quality End Of 100Bp Read
written by Bioscientist
-
Fastq Quality Check
written by toshnam
