Hi all,

I'm trying to check sequencing quality of FASTQ file from HiSeq2000. I used fastx_quality_stats script of FASTX-Toolkit (Version 0.0.13) for it. However I've got an error as follows:

$ fastx_quality_stats -i 6_1.fastq -o 6_1.stats <br />
fastx_quality_stats: Invalid quality score value (char '#' ord 35 quality value -29) on line 4

The FASTQ file really contains "#" character.

@HWI-ST621:210:C03D4ACXX:4:1101:1475:1957 1:N:0:ATCACG
NACTACAATTTACAGATAACTTTAAATTAAATTTTGGAATCAAATATAAAGATTGAAAATGAATTTTGAATATATGAAAATCCATTTAAAGAGTTTGGTAC
+
#1=DDDFFHHDHHIIIJJEHIJJJJJIIIJFIGGJJJFICGIGGGIIJIEIIIIJIJIIIIHIIIJIGGIJIIIJGHIEHJJJHHHHHHHFFF;B@CA;;@

"#" charater is invalid quality score value? I heard this FASTQ file was checked using quality trim program of NGS Cell package of CLCBio, and sequencing quality was good. Then, "#" character is invalid for FASTX-Toolkit only?

I also used Popoolation toolbox (Version 1.2.2) for quality trimming of the FASTQ, and I've got some results as follows:

$trim-fastq.pl --input1 6_1.fastq --input2 6_2.fastq --output trimmed

......................................................

FINISHED: end statistics
Read-pairs processed: 53675033
Read-pairs trimmed in pairs: 0
Read-pairs trimmed as singles: 0


FIRST READ STATISTICS
First reads passing: 0
5p poly-N sequences trimmed: 632578
3p poly-N sequences trimmed: 0
Reads discarded during 'remaining N filtering': 0
Reads discarded during length filtering: 53675033
Count sequences trimed during quality filtering: 53675033

Read length distribution first read
length  count


SECOND READ STATISTICS
Second reads passing: 0
5p poly-N sequences trimmed: 628623
3p poly-N sequences trimmed: 801
Reads discarded during 'remaining N filtering': 0
Reads discarded during length filtering: 53675033
Count sequences trimed during quality filtering: 53675033

Read length distribution second read
length  count

As you see, all of reads were trimmed during the process of quality trimming.
I've been working with some GAII and HiSeq2000 sequence data, but this is the first case. I wonder whether this problem was caused by bad sequencing quality or my mistake.

I appreciate any help.
Thanks.