how to remove specific sequences from multi-fasta file which contains N ?
Hi EveryOne,
I have a multifasta file which contains 11000 (30kb each) genomes. Now i want to remove all the reads(whole genome) which contains N (minimum atleast one N ). How can I do this with sed or awk? Thanks in advance.
I have input like this :
Genome1 ATCGTCGTACAGATACAGATACANNNcGATAGACATAGACA
Genome2 AGTCGATCAGTACAGATACAGATACAGATACAGATAC
I want output like this
Genome2 AGTCGATCAGTACAGATACAGATACAGATACAGATAC
• 2,105 views
•
link
written
by
k.kathirvel93
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
Filtering rows based on a list if all the entries of the list correspond to a specific row value
written by bionix •
-
Append characters to end of fasta sequences in a multifasta file
written by sid5427 •
-
How to remove sequence reads contains more than 1 X from multifasta file?
written by k.kathirvel93
-
Phylogenetic tree construction from MAFFT aligned large genome dataset ?
written by k.kathirvel93
-
How to perform BLASTp with two multifasta protein sequence files?
written by k.kathirvel93
-
Sort header from the multifasta sequnce file into only gene name
written by k.kathirvel93
-
How to extract sequences from multi fasta file, which contains specific primers?
written by k.kathirvel93
-
How to extract sequences from multi fasta file, which contains specific primers?
written by k.kathirvel93
-
How can I extract SNP from bacterial genome?
written by k.kathirvel93
-
how to change the header of input file
written by Raghav
Hello k.kathirvel93!
Questions similar to yours can already be found at:
We have closed your question to allow us to keep similar content in the same thread.
If you disagree with this please tell us why in a reply below. We'll be happy to talk about it.
Cheers!
Thanks @Pierre Lindenbaum, I have gone through that thread you mentioned, but it was not working fine with my large data, coz after executed that code, still the genome have Ns. Since that thread was 4 yrs old, i created my own thread. Can you help with this? Thanks
have you found a solution?