This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Append characters to end of fasta sequences in a multifasta file

Hello all,

I am trying to edit fasta sequences in a large multifasta file to serve as input for some tools.

Essentially I would like to append some characters to the end of each fasta sequence. I can write a script using python or perl, but was wondering if there is a quick and easy way to do it - say using sed or awk?

assuming I want to append a * character to the end of each fasta sequence -

I have tried this - 

perl -pe 's/\n*/*\n>/' test.fasta
sed -r 's/\n>/*\n>/' test.fasta

but these did not work, instead just printing out the same sequences with no change.

Even though this does work, appending a * character at the end of each line in the fasta file.

sed -r 's/\n/*\n/' test.fasta

I have tried adding other line ending characters in place of '/n' such as '/r', '/M' - no luck. I think I might be missing some other line ending character or symbol - or my entire logic might be off.

essentially I want my output sequences to look like this - 

>header_name
ATATCGACGCGACGTCGACGTCGACG
ATATCGACGCGACGTC*
>header_name
ATATCGAGACGTCGACGTATCGAGACG
ATATCGGAAGTC*

Any help would be appreciated!

fasta sed perl
• 3,629 views • link
written by sid5427 • sid5427

sed /$/*/ is what you want... but that will add a star to the end of each line including the header

sed "s/^\([^>]\+\)$/\1*/" will add a star to each sequence line (which is a problem for formatted fasta) *

If you're dealing with formatted fasta, I'd read the file, record by record. Whenever a new record is encountered, write the previous one and add the star to the end of the last sequence line. Otherwise you can take the second line from above.

* this doesn't work out of the box on a mac zsh

• 0 views • link
written by cschu181 cschu181

Hello,

You could try a conditioned sed

sed '/^[A-Z]/ s/$/\*/g' test.fasta
• 0 views • link
written by desouzareis.r desouzareis.r

1 answer

if you have multi-line fasta, try:

$ seqkit replace -sp '$' -r '*' test.fa

If you have flattened fasta, try:

$ sed '/^>/! s/$/*/' test.fa
• 0 views • link
written by cpad0112 cpad0112

Ah yes - I forgot about the differences between multiline and flattened fasta files. Thanks - the code snippet for the multi-line fasta worked!

• 0 views • link
written by sid5427 • sid5427

Log in to answer this question.

More posts like this