This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Filter fastq files

After removing over-represented sequences using trimmomatic my fasq file has a large number of small sequences. How can I remove these using trimmomatic if possible or other tools except awk.

fastq trimmomatic
• 1,508 views • link
updated by Istvan Albert Istvan Albert • written by ATCG ATCG

One typically does not trim overrepresented sequences. In how many percent of reads are the overrepresented sequences? Like 1 or 2%? Just leave it and proceed with alignment.

• 0 views • link
written by ATpoint ATpoint

I specifically removed this sequence: AGATCGGAAGAGCACACGTCAGAACTCCAGTCACGGAGAAATCTCGTATG 79528 0.2893519866061553 TruSeq Adapter, Index 11 (97% over 35bp)

• 0 views • link
written by ATCG ATCG

This will work cutadapt --minimum-length 20 -o output.fastq input.fastq

• 0 views • link
written by ATCG ATCG

1 answer

Consult the Trimmomatic manual

http://www.usadellab.org/cms/?page=trimmomatic

you will need to use the MINLEN action

or as seen in the manual

java -jar trimmomatic-0.39.jar PE input_forward.fq.gz input_reverse.fq.gz output_forward_paired.fq.gz output_forward_unpaired.fq.gz output_reverse_paired.fq.gz output_reverse_unpaired.fq.gz MINLEN:36

yikes for user interface. So I'd recommend using another tool.

• 0 views • link
written by Istvan Albert Istvan Albert

Log in to answer this question.

More posts like this