This is a test version of Biostars. For the public version, visit https://www.biostars.org.
rnaseq sequence analysis and trimming

Hi, I received sequences from RNAseq for mirna from a company. I have following questions regarding the sequences. As company provided following sequencing kit was used https://www.neb.com/faqs/2012/07/30/which-is-the-sequence-of-the-final-pcr-product

eg. of sequnce

Overrepresented sequences

Sequence                                                                 Count        Percentage                       Possible Source
                                                                                  2733553     24.346957954015203         No Hit
GGCTGGTCCGATGGTAGTGGGTTATCAGAACT  1389076     12.372094108631375          No Hit
TCCTGTACTGAGCTGCCCCGA                             498271         4.437954225400096          No Hit
  1. What is the difference between "adapter" and "index" sequences ? How to trim those sequences using trimmomatic or cutadapt ? The index sequences are different in different samples. However, few sequences show no index sequences but it should be there ?

  2. What are the empty sequences shown in "over represented sequences" ? HOw to remove those ?

  3. How do I make sure that I remove necessary adapters, index sequences using cutadapt or trimmomatic. The sequence length is 37 or more bp and after removing those adapter and index the final sequence length was still more than 25 bp. For miRNA, the sequence length should be short if I am not wrong. So, I think I am doing something wrong

rna-seq rna-seq fastqc trimmomatic cutadapt

0 answers

No answers yet.

Log in to answer this question.