over-represented is not removed after trimmomatic
I am trimming over-represented sequences using the following:
#make .fa with sequence found to be over-represented
echo ">illumina" > adapter.fa
echo "AGATCGGAAGAGCACACGTCAGAACTCCAGTCACAACCAGATCTCGTATG" >> adapter.fa
#Run trimmomatic using the adapter.fa
trimmomatic SE WT_1.fastq.gz WT_1.trim.fastq.gz ILLUMINACLIP:adapter.fa:2:30:5
#Run Fastqc
fastqc WT_1.trim.fastq.gz
After running fastqc on the trimmed file I still have the same over-represented sequence
TrimmomaticSE: Started with arguments:
WT_1.fastq.gz WT_1.trim.fastq.gz ILLUMINACLIP:adapter.fa:2:30:5
Automatically using 1 threads
ILLUMINACLIP: Using 0 prefix pairs, 0 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Quality encoding detected as phred33
Input Reads: 21296189 Surviving: 21296189 (100.00%) Dropped: 0 (0.00%)
TrimmomaticSE: Completed successfully
(bioinfo)
• 1,801 views
•
link
0 answers
No answers yet.
Log in to answer this question.
could you perhaps share (part of) the fastQC plots which hinted you at this over representation?
and not sure but I think that trimmomatic (as well many other software) will only clip if the 'sequence' is at the extremities of the read (?)
The problem that my adapter.fa file was not in the path: ILLUMINACLIP: Using 0 prefix pairs, 0 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
when it works TrimmomaticSE: Started with arguments: WT_1.fastq WT_1.trim.fastq ILLUMINACLIP:adapter.fa:2:30:5 Automatically using 1 threads
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCAGAACTCCAGTCACAACCAGATCTCGTATG' ILLUMINACLIP: Using 0 prefix pairs, 1 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences Quality encoding detected as phred33