over-represented is not removed after trimmomatic

I am trimming over-represented sequences using the following:

#make .fa with sequence found to be over-represented
echo ">illumina" > adapter.fa
echo "AGATCGGAAGAGCACACGTCAGAACTCCAGTCACAACCAGATCTCGTATG" >> adapter.fa

#Run trimmomatic using the adapter.fa
trimmomatic SE WT_1.fastq.gz WT_1.trim.fastq.gz ILLUMINACLIP:adapter.fa:2:30:5

#Run Fastqc
fastqc WT_1.trim.fastq.gz

After running fastqc on the trimmed file I still have the same over-represented sequence

TrimmomaticSE: Started with arguments:
 WT_1.fastq.gz WT_1.trim.fastq.gz ILLUMINACLIP:adapter.fa:2:30:5
Automatically using 1 threads
ILLUMINACLIP: Using 0 prefix pairs, 0 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Quality encoding detected as phred33
Input Reads: 21296189 Surviving: 21296189 (100.00%) Dropped: 0 (0.00%)
TrimmomaticSE: Completed successfully
(bioinfo)

trimmomatic fastqc

• 1,802 views • link

written 6.3 years ago by ATCG

could you perhaps share (part of) the fastQC plots which hinted you at this over representation?

and not sure but I think that trimmomatic (as well many other software) will only clip if the 'sequence' is at the extremities of the read (?)

• 0 views • link

written 6.3 years ago by lieven.sterck

The problem that my adapter.fa file was not in the path: ILLUMINACLIP: Using 0 prefix pairs, 0 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences

when it works TrimmomaticSE: Started with arguments: WT_1.fastq WT_1.trim.fastq ILLUMINACLIP:adapter.fa:2:30:5 Automatically using 1 threads

Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCAGAACTCCAGTCACAACCAGATCTCGTATG' ILLUMINACLIP: Using 0 prefix pairs, 1 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences Quality encoding detected as phred33

• 0 views • link

written 6.3 years ago by ATCG

0 answers

No answers yet.

More posts like this

Too many unpaired forward reads found by Trimmomatic
written 2.2 years ago by SilhouetteQ •

Hi, I am analyzing ATAC-Seq PE data using **Trimmomatic-0.39**, TrimmomaticPE: Started with arguments: -threads 16 -phred33 ./data/R1.fastq.gz ./data/R2.fastq.gz R1_paired.fq.gz R1_unpaired.fq.gz R2_paired.fq.gz R2_unpaired.fq.gz ILLUMINACLIP:./NexteraPE-PE.fa:2:30:10 LEADING:3 TRAILING:3 …
Low number of both surviving reads after trimming
written 2.4 years ago by Jay •

Hi, Trimming using Trimmomatic gave me these results: code trimmomatic PE -phred33 R1.fastq.gz R2.fastq.gz R1.paired.fastq.gz R1.unpaired.fastq.gz R2.paired.fastq.gz R2.unpaired.fastq.gz ILLUMINACLIP:adapter.fa:2:30:10 LEADING:20 TRAILING:20 SLIDINGWINDOW:4:15 MINLEN:25 output Input …
Does this mean it is running? It has been like this for a while. I am using Trimmomatic.
written 3.7 years ago by sam •

``` java -jar /path/to/trimmomatic-0.39.jar \ PE -trimlog trimlog_20191205.B-2744XJ_3.txt 20191205.B-2744XJ_3_1.fastq.gz 20191205.B-2744XJ_3_2.fastq.gz \ SRR2589044_1.trim.fastq.gz SRR25> 89044_1un.trim.fastq.gz \ SRR2589044_2.trim.fastq.gz SRR2589044_2un.trim.fastq.gz \ SLIDINGWINDOW:4:20 M> INLEN:25 ILLUMINACLIP:TruSeq3-PE.fa:2:40:15> > TrimmomaticPE: Started …
Trimmomatic seems not working
written 4.5 years ago by salmon •

Hello, I am using paired end RNA sequence for transcriptomic analysis. java -jar trimmomatic-0.39.jar PE Data/K1_R1.fastq Data/K1_R2.fastq K1_R1_paired.fastq K1_R1_unpaired.fastq K1_R2_paired.fastq K1_R2_unpaired.fastq ILLUMINACLIP:TruSeq3-PE.fa:2:30:10:2:True LEADING:3 TRAILING:3 MINLEN:36 …
Confusion about trimmomatic
written 5.7 years ago by szahid •

Hi All, I'm new to bioinformatics and currently working on some rna seq data. I'm using trimmomatic to remove adaptor contamination. I'm using the following …
What sequences should I use for ATAC-Seq adapter trimming using trimmomatic 0.36?
written 7.4 years ago by Gary

Hi, I want to use Trimmomatic 0.36 to trim ATAC-Seq adapter sequences. However, I am not sure which sequences I should use to trim our …
Interpretation of Trimmomatic Results after Paired-End Adapter Trimming
written 8.1 years ago by sevenless •

Hi, I have some questions concerning the output of Trimmomatic after adapter removal. I have 80 bp paired-end reads in Ilumina 1.9 encoding (Phred+33). Using …
Trimmomatic not displaying summary
written 8.7 years ago by kiddodoraemon •

Hello all, i am a beginner in this field. i'm grateful for your advice and help : i was running Trimmomatic0.36 on terminal using my …
Interpretation of Results from trimmomatic
written 8.9 years ago by AP •

Hi everyone, I just got my results after I ran trimmomatic command. I had 50bp paired end reads for which I ran the following command …
Trimmomatic not able to remove low sequence bases
written 11.4 years ago by David_emir

Hello Friends, I am dealing with an RNA-Seq Paired end data. My goal is to identify Differential expressed genes. While preprocessing the data I wanted …