More posts like this
-
ATAC-Seq and RPKM
written by qudrat.nii 4Hi, I want to calculate RPKM of ATAC-Seq data but I do not find any script for that. As I am new to bioinformatics, so …
-
KaKs calculator
written by Abdukhalim Khon 0Hi everyone. I am working with eremurus species. This is my first individual work and I have 27 new sequenced chloroplast genomes of Eremurus. I …
-
CDS for many genes
written by 2018204052 0hi all could you please guide me how I can get the CDS for many genes (around 2000)?I just have the gene IDs that I …
-
SNPs from RNA-Seq Compare with SNPs from DNA-Seq
written by drragill 1Hi, I have two questions... 1. I wanted to compare the SNPs variation due to transcription. So, I called SNPs from RNA-Seq of 321 samples …
-
Mya calculation for estimation of evolutionary time scale
written by memohansingh 1Dear all, Can somebody suggest me programs or software to calculate the Mya (age in millions) for individual genes and/or for the organism to predict …
-
Is there any tool to calculate dn/ds for orthologues?
written by ThulasiS 9Hi all I am trying to calculate dn/ds ratio for several genes. I am trying to analyze the selection pressure on several bacterial genes. I …
-
Allele Frequency Calculator
written by 786 5Hi I'm using **1000 genome browser** and want to retrieve data related to Allele frequency using Allele Frequency Calculator. When I entered chromosome and gene …
-
Fasta to axt - KaKs Calculator
written by tlorin 37Dear BioStars Users, I am using KaKs Calculator to estimate selection over a whole sequence, and I need to do this for many multifasta alignments. …
-
Sequencing By Hybridization Data Analysis
written by jack 52<p>I have NGS data of a gene, it's sequenced by SBH technology.as sequencing library, a hexamer library is used (4 in power of 6). like …
-
Kaks Calculator
written by figo 22<p>Hi All</p> <p>I used the KaKs calculator to calculate the omega value. I got many instances where the omega values are greater then 1. But …
Please read the tool documentation, follow it accordingly, and then, if you encounter problems, post a question here. In the question, be as detailed as possible, for example, including a link to the tools page, and try to include sample data to reproduce the error.
Are you referring to the Ka/Ks calculator found here?
https://kakscalculator.herokuapp.com/
Dear h.mon and Dave Carlson,
Many thanks for your kind reply. But I encounter a problem as...Original Sequence has unconventional nucleotides. My input sequence (both) was in fasta format as below...
ATGAAAGGCACGTTATCACCCGCTCTAGGGAACCTCGGATCTCTCCAGGTTTTGTTCATT TCTGGAACCAAGTTCATTGCCGGCTCGATTCCCAACAGCTTCTCTAAGCTAACTAGTCTT ACTCAGCTCGTCCTCGATGATAACTCTCTCCAAGGCAACGTTCCTTCTTGTTTAGGCCAT CTTCCGTTCTTGGAGATTCTTTCATTGGCTGGAAACCGTTTCTCAGGTGTTGTCCCAGCG AGTTTGGGGAGCTTGAGAAGCCTCTCTGTGATGATGTTGGCTCGAAACTCTCTCTCTGGT CCAATCCCAGTGACGTTCAAGAACCTTGTCAAGCTTCAGACTCTTGACCTCAGCTTCAAT ATGTTATCTGGACCGATACCAGACTTCATAGGCCAGTTTCGGAATCTAACAACTCTTGAT CTCTCCAGCAACAGATTCTCCGGGGGACTACCGGTTTCTGTTTACAACTTGGGGAAGCTT
Could you please guide me on which format I should input..in detail. Many thanks!
Sincerely
This (these?) sequence is not in fasta format, and I don't see any unconventional characters in it.