Sequencing By Hybridization Data Analysis

I have NGS data of a gene, it's sequenced by SBH technology.as sequencing library, a hexamer library is used (4 in power of 6). like this :

TTTGAGGTGCAGATAGCTTGCTTTATTTTGTTGTTACTATCTCAAGGAGG
TCCAACAATTATAACTAACAATTGAATTTATACTTGCATGAAAAGAACTA
CATCAAATTGACATTTTGGGCAATTAGTAATATTGTTTAAAATTTAACAA
CAGCTTTATTTTGTTGTTGTTCTTTACTTTTTGCTGTGGCTCATTGCTTA
GGTGCCCAGGTTTTTCAGGTGCAATTAAAATTTAGAACTACCACACAAAG
GCATTGGCTGCACTCTGGGACCTCCAAGAGTTGGCACTGCTCTGGCATAG
GAATACTTGAATAGCTTGGTTAAATGAAGGGATGGCCAGGAGATGTTACT
.
.
.

I want to calculate the following things :

i) how many percent of gene I can discover uniquely with this hexamer library (assume all hexamer are used in library)

ii) how many different hexamer are present in this gene

Can somebody guide me how can I calculate them ?

ngs bioinformatician statistics bioconductor genomics

• 1,974 views • link

updated 12.7 years ago by Ido Tamir

• written 12.7 years ago by jack •

1 answer

scala:

>val hexamerMap = gene.sliding(6).toList.groupBy(s => s).mapValues(_.length)
>hexamerMap.size
res11: Int = 301
>hexamerMap.values.groupBy(c => c).mapValues(_.toSeq.length).toList.sortBy(_._1)
res14: List[(Int, Int)] = List((1,264), (2,30), (3,7))

So 246 hexamers are there once, 30 twice and 7 thrice. From this one could calculate the percentage of uniquely coverage, if I understood your question i correctly.

Edit: actually I don't really understand question i.

• 0 views • link

written 12.7 years ago by Ido Tamir

More posts like this

How To Map Ucsc Mrna Isoforms To Gene ?
written 12.5 years ago by jack •

I have isoform expression file of human cancer from TCGA. I want to map all this isoform to gene, in other word, I want to …
How To Map Isoform Ids Of Transcript To Entrez Ids ?
written 12.5 years ago by jack •

Hi, I've got RNA-seq data from TCGA. I have gene expression level and also isoform expression level. I want to know how can I map …
Scatterplots Showing Correlation Between Gene Pairs
written 12.9 years ago by spaul8505 •

I have two dataframes <pre><code> x<-data.frame(matrix(rnorm(1000), nrow=1000, ncol=10)) y<-data.frame(matrix(rnorm(1000), nrow=1000, ncol=10)) </code></pre> where the rows are the genes and the columns are samples. I wanted …
Computing T-Test For Genes With Help Of Apply Function
written 12.9 years ago by jack •

I have a matrix : <pre><code>>data A A A B B C gene1 1 6 11 16 21 26 gene2 2 7 12 17 22 …
What Is The Best Way To Calculate Gene Expression From Affymetrix Data
written 13.0 years ago by Sirus

Hello everybody, Sorry to ask this kind of questions, but just to be sure. I am just confused on how to calculate the expresion value …
Matching Ensembl Ids In Input And Library File Using R
written 13.4 years ago by Diana

Hi everyone! I have 2 files and I want to compare the Ensembl Gene Ids in my input file to Ensembl Gene Ids in the …
Tophat Mapping Rate With Rna-Seq.
written 13.5 years ago by C Shao •

I am confused about my RNA-seq mapping results from tophat. It's pair-end sequencing data, 101 bp length from Hiseq 2000. Here is the command …
[R] Coverage Per Gene
written 13.6 years ago by Jetse •

Hello everyone, To calculate the coverage of a bam file, I used <a href="http://www.biostars.org/p/5165/#5179">this</a> answer. I have an GRangesList object with all genes and their …
Plotting Exons Of A Transcript Using Bioconductor Genomegraphs
written 14.4 years ago by Tonig

Hi, I was looking the list but there was no response to my questions: How do I plot the exons of a specific transcript of …
Multiple Sequence Alignment
written 15.0 years ago by Sanju •

How to import clustalw output(.aln file) to R? My sequences are in fasta format.I used the following code <pre><code>> library(seqinr) > myseqs <- read.alignment("seqs.fasta", format …