This is a test version of Biostars. For the public version, visit https://www.biostars.org.
CDS for many genes

hi all could you please guide me how I can get the CDS for many genes (around 2000)?I just have the gene IDs that I got from RNA seq results, now I need the CDS for all of them. is there any software that can be useful in this regard? I'll appreciate if somebody helps me to get the answer.

sequencing
• 641 views • link
written by 2018204052 • 2018204052

1 answer

Please post example of gene ID's and organism they are from.

You could use EntrezDirect with something like following.

esearch -db nucleotide -query "NM_033668.2" | efetch -format fasta_cds_na

will get you (truncated for space)

>lcl|NM_033668.2_cds_NP_391988.1_1 [gene=ITGB1] [db_xref=GeneID:3688,HGNC:HGNC:6153,MIM:135630] [protein=integrin beta-1 isoform 1D precursor] [protein_id=NP_391988.1] [location=1..2406] [gbkey=CDS]
ATGAATTTACAACCAATTTTCTGGATTGGACTGATCAGTTCAGTTTGCTGTGTGTTTGCTCAAACAGATG
AAAATAGATGTTTAAAAGCAAATGCCAAATCATGTGGAGAATGTATACAAGCAGGGCCAAATTGTGGGTG
GTGCACAAATTCAACATTTTTACAGGAAGGAATGCCTACTTCTGCACGATGTGATGATTTAGAAGCCTTA
AAAAAGAAGGGTTGCCCTCCAGATGACATAGAAAATCCCAGAGGCTCCAAAGATATAAAGAAAAATAAAA
• 0 views • link
written by GenoMax GenoMax

Log in to answer this question.

More posts like this