binary tp nucleotide convertion

How to convert DArT file containing binary (0, 1) into AT,GC format. Kindly suggest it

gwas snp nucleotide binary

• 1,196 views • link

written 7.8 years ago by bulbul •

0 answers

No answers yet.

More posts like this

Tabix file format
written 5.4 years ago by georgians •

Hello, I am using matrixeqtl package for predicting the cis and trans eqtls. I want to visualize my data with the locus zoom, for that, …
error in Conversion GFF3 to sequin TBL
written 7.5 years ago by iqra •

i want to convert the gff3 file into sequin tbl format. i use the script [enter link description here][1] but i found this error .kindly …
How to convert Multiple sequence alignment format (fasta, Mega etc.,) to binary MSA fasta format fo…
written 7.6 years ago by Kumar

I need to carryout gene gain and loss analysis of my multiple bacterial genomes in GLOOME server. For which, I need to have binary MSA …
Conversion of binary to ATGC
written 7.8 years ago by bulbul •

CloneID Sequence CloneID P1 P2 1 2 3 4 11061 TCGCTGTACACTGTTGACGTCGCC 11061 1 1 1 1 1 1 11294 AAAGGTTCTATCTCGCTGAAACCCAG 11294 0 1 1 1 …
conversion binary to ATGC
written 7.8 years ago by bulbul •

CloneID Sequence CloneID P1 P2 1 2 3 4 11061 TCGCTGTACACTGTTGACGTCGCC 11061 1 1 1 1 1 1 11294 AAAGGTTCTATCTCGCTGAAACCCAG 11294 0 1 1 1 …
Convert .gprobs files to PLINK format
written 8.1 years ago by lauretomas •

Hello all, I have some imputed .gprobs files (one per chromosome), imputed by Impute2 downloaded from dbGaP, and I need to convert this file into …
sequence in different line
written 9.0 years ago by Bulbul Ahmed •

I have fasta file in this format (one line) >accession1 GGGGAGCTACGGCAGCGGCGGCGGGGTGCTGCCGCTGGCGTCGCTTAA >accession2 TTCCGGTAGAAAATCCATTATTGCCAATGGAAGAAGTGA How will i convert into the below format(seperate line for sequence) using …
file format for joimap
written 9.6 years ago by claudia_io_p •

How to convert vcf files to joinmap format? I have a vcf file containing SNPs from parents and F1 offspring. I need to convert this …
bioinformatics command line
written 10.8 years ago by Bulbul Ahmed •

May I get the commands for bowtie2 in pbs script for mapping assembled data. kindly give me it in < Email address removed > My …
How To Convert A Fasta Sequence Format Into Binary Format (0-1)?
written 12.8 years ago by amritayadav1991 •

<p>how to convert fasta sequence format into binary format (0-1) ???</p>