More posts like this
-
Tabix file format
written by georgians 5Hello, I am using matrixeqtl package for predicting the cis and trans eqtls. I want to visualize my data with the locus zoom, for that, …
-
error in Conversion GFF3 to sequin TBL
written by iqra 0i want to convert the gff3 file into sequin tbl format. i use the script [enter link description here][1] but i found this error .kindly …
-
How to convert Multiple sequence alignment format (fasta, Mega etc.,) to binary MSA fasta format fo…
written by Kumar 12I need to carryout gene gain and loss analysis of my multiple bacterial genomes in GLOOME server. For which, I need to have binary MSA …
-
Conversion of binary to ATGC
written by bulbul 1CloneID Sequence CloneID P1 P2 1 2 3 4 11061 TCGCTGTACACTGTTGACGTCGCC 11061 1 1 1 1 1 1 11294 AAAGGTTCTATCTCGCTGAAACCCAG 11294 0 1 1 1 …
-
conversion binary to ATGC
written by bulbul 1CloneID Sequence CloneID P1 P2 1 2 3 4 11061 TCGCTGTACACTGTTGACGTCGCC 11061 1 1 1 1 1 1 11294 AAAGGTTCTATCTCGCTGAAACCCAG 11294 0 1 1 1 …
-
Convert .gprobs files to PLINK format
written by lauretomas 1Hello all, I have some imputed .gprobs files (one per chromosome), imputed by Impute2 downloaded from dbGaP, and I need to convert this file into …
-
sequence in different line
written by Bulbul Ahmed 2I have fasta file in this format (one line) >accession1 GGGGAGCTACGGCAGCGGCGGCGGGGTGCTGCCGCTGGCGTCGCTTAA >accession2 TTCCGGTAGAAAATCCATTATTGCCAATGGAAGAAGTGA How will i convert into the below format(seperate line for sequence) using …
-
file format for joimap
written by claudia_io_p 0How to convert vcf files to joinmap format? I have a vcf file containing SNPs from parents and F1 offspring. I need to convert this …
-
bioinformatics command line
written by Bulbul Ahmed 2May I get the commands for bowtie2 in pbs script for mapping assembled data. kindly give me it in < Email address removed > My …
-
How To Convert A Fasta Sequence Format Into Binary Format (0-1)?
written by amritayadav1991 1<p>how to convert fasta sequence format into binary format (0-1) ???</p>