This is a test version of Biostars. For the public version, visit https://www.biostars.org.
conversion binary to ATGC
CloneID                  Sequence                               CloneID P1  P2  1   2   3   4
11061   TCGCTGTACACTGTTGACGTCGCC        11061   1   1   1   1   1   1
11294   AAAGGTTCTATCTCGCTGAAACCCAG  11294   0   1   1   1   1   1
22912   ACCATCGCTGCACCACCTTGACCT             22912  1   -   1   1   1   1
11324   AGCAGCGTCGACTGCCGAGATCGG            11324   1   1   1   1   1   1
10918   GACGTGGCCGAGATCGGAAGAGC         10918   -   1   1   1   1   1
22617   AGCAGCGGTGTGTCACCATGGGGTG   22617   0   1   1   1   -   1
30239   TACCTCCGAGATCGGAAGAGCGGTTCG 30239   -   1   1   1   1   1
18650   GACTTGCCTGCGCGCCGCC                 18650   1   1   1   1   1   1
10995   TGAAATGCCGTGCATGATTAA               10995   1   1   1   -   1   1
11261   TAGGTTACCTTCCGAGATCGGAAG           11261    1   1   1   1   1   1

This is my DArT example data (it's already in biallelic format). How Should i convert into AT, GC format for each binary digit? Kindly help me. Thanks in advance.

snp gwas

Please use the formatting bar (especially the code option) to present your post better. I've done it for you this time.
code_formatting

Thank you!

Hi, Can you please clearly mention which binary digit data belongs to which nucleotide?

"0" = Reference allele homozygote, "1"= SNP allele homozygote, "-" = missing. But I do not know to to convert the above example data into AT GC AA CC like. kindly suggest me. thank you.

This format is the output from which program? Aren't there any accompanying input / output files? How did you obtain this output?

With the information you provided, it is impossible to help in any way.

I have done it for you this time. However, please follow what genomax told in his comment from next time onwards

0 answers

No answers yet.

Log in to answer this question.