sequence in different line
I have fasta file in this format (one line)
>accession1 GGGGAGCTACGGCAGCGGCGGCGGGGTGCTGCCGCTGGCGTCGCTTAA
>accession2 TTCCGGTAGAAAATCCATTATTGCCAATGGAAGAAGTGA
How will i convert into the below format(seperate line for sequence) using perl script or any other way
>accession1
GGGGAGCTACGGCAGCGGCGGCGGGGTGCTGCCGCTGGCGTCGCTTAA
>accession2
TTCCGGTAGAAAATCCATTATTGCCAATGGAAGAAGTGA
• 3,472 views
•
link
updated
by
GenoMax
•
written
by
Bulbul Ahmed •
•
written
by
Bulbul Ahmed •
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
Combining unpaired and paired-end reads in spades assembly
written by rescueson •
-
Haplotype Calling Using GATK HaplotypeCaller to Get Exact 35718025 Positions/Loci
written by yenon118 •
-
How to alter the program to a universal format converter
written by Mimmi Ahlmén •
-
seperate partial cds from complete cds
written by Bulbul Ahmed •
-
Convert paired end fastq file to fasta format
written by Abdul Rafay Khan
-
Run Prediction program on entire folder.
written by enkh.tug •
-
fasta to sfata
written by Bulbul Ahmed •
-
bioinformatics command line
written by Bulbul Ahmed •
-
Converting ANY blast output file to an alignment fasta file.
written by ddusan1 •
-
How To Convert A Plain Squence In A Perl String Variable To Fasta Format
written by Curious Mind •
Substitute tab or space with newline use unix tr
which command should i use in rehat??
Although we can't see which whitespace is between your accession identifier and the actual sequence.
thank so much sir. i will try this, hopefully it will work
Maybe
sed -r 's#\s+#\n#' input >outputthen?Bah, I prefer:
So, a different delimiter?
Exactly ;-)
[just some slight Friday night trolling]
Strictly speaking, this is not really bioinformatics.
I don't know... it seems like an awful lot of bioinformatics is just reformatting text files :)
Personally, in this case, I would copy and paste into Notepad++, which allows search/replace of \t for \n. But then I had never seen "tr" before, so I learned something from the thread!
tris good, but I use it more for squeezing consecutive white spaces (tr -s) or for quick deletion (tr -d) than to replace. I prefersedfor all replace operations as it has better granular control.Then it's not a FASTA. While it's not a bioinformatics question per se, the OP is at least using a file with sequence information.
Yeah, it satisfies that, but really? A find+replace operation?