actully i want to pull out the multiole sequences file using gene id in another file, so some one said me to convert fasta file to sfasta file. i used (grep -A 5 -wFf gene_id.txt assembled_sequence.fasta > OUT.fasta) command to pull out the sequences but its giving some more sequences also which are not present in the gene_id.txt. is there any alternate option?? or is there any mistakes in the above command?? please correct it
Don't post the same question under a different/misleading title (like this one). You had asked this question in another thread already (perl programming for retriving sequences sequenc ). There is no format called sfasta. Since we can't see your files there is no way to tell why you are getting nothing from the command you posted above.
I have fasta file in this format (one line) >accession1 GGGGAGCTACGGCAGCGGCGGCGGGGTGCTGCCGCTGGCGTCGCTTAA >accession2 TTCCGGTAGAAAATCCATTATTGCCAATGGAAGAAGTGA How will i convert into the below format(seperate line for sequence) using …
Can you give more context to your question, i.e. why you're trying to do this? I have to admit, I've never heard of the "sfasta" format.
actully i want to pull out the multiole sequences file using gene id in another file, so some one said me to convert fasta file to sfasta file. i used (grep -A 5 -wFf gene_id.txt assembled_sequence.fasta > OUT.fasta) command to pull out the sequences but its giving some more sequences also which are not present in the gene_id.txt. is there any alternate option?? or is there any mistakes in the above command?? please correct it
grep -A 5 -wFf <( sed -r 's/^/gene id: /' gene_id.txt ) assembled_sequence.fasta > OUT.fasta. but is giving nothing
Don't post the same question under a different/misleading title (like this one).
You had asked this question in another thread already (perl programming for retriving sequences sequenc ).
There is no format called sfasta.
Since we can't see your files there is no way to tell why you are getting nothing from the command you posted above.
What is sfasta? (title says sfata??)
In general it is better to provide adequate information when asking questions.
Hello Bulbul Ahmed!
We believe that this post does not fit the main topic of this site.
Closed until OP elaborates on the question and explains how this is not the same as OP's previous question here: perl programming for retriving sequences sequenc
For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with.
If you disagree please tell us why in a reply below, we'll be happy to talk about it.
Cheers!