Hi,
I have been analyzing a set of small RNA seq and I encountered a small problem with fasta/fastq files. After trimming and collapsing, I wanted to filter for reads that are 22 nt long with a Guanine in the 5'. This is the code I used to filter the reads:
cat input_wt3_trimmed_collapsed_1_2.fq | paste - - | awk 'length($4) >= 22 && length($4) <=22' | sed 's/\t/\n/g' > input_wt3_trimmed_collapsed_2.fq
awk '$2 ~ /^G/' elution_wt1_trimmed_collapsed_1_2.fq > elution_wt1_trimmed_collapsed_1_2_22Gs_2.fq
However, these command lines converted my fasta/fq files into one line fasta format from two lines format, here is the example:
before:
>1-1763
TACCCGTATAAGTTTCTGCTGAG
>2-1550
TGAGATCGTTCAGTACGGCAA
after:
>73-969 GAGATCGGGCGGGAAGTGGTAT
>89-940 GTTTCCGGCTCACGTCCTCTGA
>90-938 GCGTGTAAGTTCGGCGGCGTGA
I would really appreciate if you guys have any better way of fixing this problem. When I want to map these reads with STAR, it is not recognised as compatible. I guess I need to convert the final file into a two lines fasta file such as:
>73-969
GAGATCGGGCGGGAAGTGGTAT
>89-940
GTTTCCGGCTCACGTCCTCTGA
>90-938
GCGTGTAAGTTCGGCGGCGTGA
What could be the best way to fix this problem?
best
Ahmet
•
written
by
canberkyurek •
1 answer
Looks like you need to convert a space to a newline, try with tr
cat elution_wt1_trimmed_collapsed_1_2_22Gs_2.fq | tr ' ' '\n' > output.fq
yup, that also works
Thanks mate! this solved the problem completely!
Glad to help.
If an answer was helpful you should upvote it, if the answer resolved your question you should mark it as accepted.
Thanks! I will follow your suggestions!
Welcome to biostars. Interesting guidelines for posting can be found in the following posts:
Log in to answer this question.
please reformat the examples. everything is just one line. also its length($4) == 22 and in awk you can also test for G at 5'
from your code in OP, I understand that you are parsing a fq file and your output is also fastq file . But examples provided by you are neither fastq/fq nor fasta. Could you please post a record or few records from fq?
I added (code) markup to your post for increased readability. You can do this by selecting the text and clicking the 101010 button. When you compose or edit a post that button is in your toolbar, see image below: