Hello everyone, newbie question here. I have 9 paired-end RNA-seq fastq files. I have done some qc with FastQC. My reads are of good quality as everything has the green check mark except the adapters. I have some questions, to clip the adapters or not to, and is it possible to write the trimmomatic script to only clip adapters, i.e no trimming? Also, where I am going wrong in the script below? When I run it, it runs foe 1 second and gives a "completed" exit code.
Many thanks
for R1 in *R1*
do
R2=${R1//R1_001_.fastq.gz/R2_001_.fastq.gz}
R1paired=${R1//.fastq.gz/_paired.fastq.gz}
R1unpaired=${R1//.fastq.gz/_unpaired.fastq.gz}
R2paired=${R2//.fastq.gz/_paired.fastq.gz}
R2unpaired=${R2//.fastq.gz/_unpaired.fastq.gz}
echo "java -jar /c1/apps/trimmomatic/Trimmomatic-0.33/trimmomatic-0.33.jar PE
-phred33 -trimlog Trimmed.txt $R1 $R2 $R1paired $R1unpaired $R2paired $R2unpaired
ILLUMINACLIP:/c1/apps/trimmomatic/Trimmomatic-0.33/adapters/TruSeq3-PE.fa:2:30:10"
>> trimmomatic.cmds
done
•
written
by
imesi •
2 answers
I see two errors on your loop:
1) I have no idea of what this line does, but apparently it just assigns the value stored in $R1 to $R2:
R2=${R1//R1_001_.fastq.gz/R2_001_.fastq.gz}
2) with echo you are not running anything, you are just echoing the text to standard output (stdout), and with >> you are redirecting and appending stdout to the file "trimmomatic.cmds" - you may inspect it with less trimmomatic.cmds and see how your trimmomatic would be, in case you remove the echo "".
Trimmomatic loops are popular... have a look at these posts for inspiration:
automated script to trim paired end RNA seq reads using Trimmomatic
Linux for loop for 2 inputs and 4 outputs for Trimmomatic fastq quality trimming
Trimmomatic job script to run on multiple pair end read file
Using trimmomatic on multiple paired-end read files
How to read a loop over to read a file in a folder for many folders
Hi h.mon, Could you please take a look at my script and tell me where I am wrong?
module load trimmomatic
for f1 in *.fastq.gz
do
f2=${f1%%1.fastq.gz}".fastq.gz"
java -jar /<path to trimmomatic> PE -threads 16 \
-phred33 -trimlog Trimlog \
$f1 \
$f2 \
adapterRemoved_Paired.fastq.gz \
adapterRemoved_Unpaired.fastq.gz \
adapterRemoved_Paired.fastq.gz \
adapterRemoved_Unpaired.fastq.gz \
ILLUMINACLIP: <path to trimmomatic>trimmomatic/Trimmomatic-0.33/adapters/TruSeq3-PE.fa:2:30:10 \
LEADING:3 TRAILING:3 MINLEN:36 \
done
This is the error message I get the error message below:
TrimmomaticPE: Started with arguments: -threads 16 -phred33 -trimlog Trimlog Control-1_R1_001.fastq.gz Control-1_R1_00.fastq.gz adapterRemoved_Paired.fastq.gz adapterRemoved_Unpaired.fastq.gz adapterRemoved_Paired.fastq.gz adapterRemoved_Unpaired.fastq.gz ILLUMINACLIP:/c1/apps/trimmomatic/Trimmomatic-0.33/adapters/TruSeq3-PE.fa:2:30:10 LEADING:3 TRAILING:3 MINLEN:36
Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
ILLUMINACLIP: Using 1 prefix pairs, 0 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Exception in thread "main" java.io.FileNotFoundException: C-1_R2_00.fastq.gz (No such file or directory)
at java.io.FileInputStream.open(Native Method)
at java.io.FileInputStream.<init>(FileInputStream.java:138)
at org.usadellab.trimmomatic.fastq.FastqParser.parse(FastqParser.java:127)
at org.usadellab.trimmomatic.TrimmomaticPE.process(TrimmomaticPE.java:255)
at org.usadellab.trimmomatic.TrimmomaticPE.run(TrimmomaticPE.java:499)
at org.usadellab.trimmomatic.Trimmomatic.main(Trimmomatic.java:35)
Thank you
Are you editing the error message? The command line shows the input fastq names are Control-1_R1_001.fastq.gz Control-1_R1_00.fastq.gz, but the error message says:
C-1_R2_00.fastq.gz (No such file or directory)
Again, I see two errors in your loop:
1) you are globing both R1 and R2 filenames with for f1 in *.fastq.gz, you want something like:
for f1 in *_R1_001.fastq.gz
2) your manipulation of the value of $f1 here is wrong, hence you are passing the non-existing file Control-1_R1_00.fastq.gz, instead of the correct Control-1_R2_001.fastq.gz. You have to modify f2=${f1%%1.fastq.gz}".fastq.gz" to:
f2=${f1%%_R1_001.fastq.gz}"_R2_001.fastq.gz"
You can try a script that I have written sometime back. Hosted on github
The script can be used for running trimmomatic automatically for N no.of samples regardless of the file extension. See this github link to understand the functionalities, usage and reasons for failure.
Thank you, Vijay. I have looked at the links you provided, including the one about the functionalities.
My files are .fq.gz. Also, I have 9 PE files (total of 18). Does this make N=9 or N=18? Also based on your script, it should be run as sh auto_trim.sh *.fq.gz but I do not understand the following:
red=`tput setaf 1`
green=`tput setaf 2`
yellow=`tput setaf 3`
reset=`tput sgr0`
count=0
Also, is this the beginning of the script?
if [[ ( $1 == '-h' ) || ( $1 == '--help') ]] ;then
usage
elif [[ $# -eq 0 ]] ;then
echo "${red}Error: No parameter(s) provided${reset}"
usage
exit 0
else
•
written
by
imesi •
My files are .fq.gz. Also, I have 9 PE files (total of 18). Does this make N=9 or N=18?
Here, N = 9. The script automatically considers paired end files (R1 and R2) based on file names
Also based on your script, it should be run as sh auto_trim.sh *.fq.gz but I do not understand the following:
red=tput setaf 1 green=tput setaf 2 yellow=tput setaf 3 reset=tput sgr0 count=0
I was trying to add some visual appeal to the command line using tput command (may sound foolish). It has nothing to do regarding trimmomatic; it's just adding color to the help/error message fonts. See this
Also, is this the beginning of the script?
if [[ ( $1 == '-h' ) || ( $1 == '--help') ]] ;then usage elif [[ $# -eq 0 ]] ;then echo "${red}Error: No parameter(s) provided${reset}" usage exit 0 else
That for invoking help message as you can see in the image above.
You just need to run the script in the folder having your fastq files like this
$ sh auto_trimmomatic.sh *.fq.gz
I am using this on a daily basis and it works as expected for me. You need to change the parameters for trimmomatic from within the script. Let me know if you face any issue.
This is PE
All the parameters are in this section of the code
PE \
-threads 10 \
-phred33 $R1 $R2 $R1_pair $R1_unpair $R2_pair $R2_unpair \
HEADCROP:7 \
ILLUMINACLIP:/data/results/adapter.fasta:2:30:8 \
LEADING:20 \
TRAILING:20 \
SLIDINGWINDOW:20:20 \
MINLEN:40
You need to simply delete the line for the param which is not required or edit the value within the code. For example, say you dont need to HEADCROP the fastq, so the modified version will be (notice that I deleted "HEADCROP" line) :
PE \
-threads 10 \
-phred33 $R1 $R2 $R1_pair $R1_unpair $R2_pair $R2_unpair \
ILLUMINACLIP:/data/results/adapter.fasta:2:30:8 \
LEADING:20 \
TRAILING:20 \
SLIDINGWINDOW:20:20 \
MINLEN:40
or say you need more threads (say 20 threads) to run trimmomatic, the modified version would be (NOTICE that I changed the threads from 10 to 20) :
PE \
-threads 20\
-phred33 $R1 $R2 $R1_pair $R1_unpair $R2_pair $R2_unpair \
HEADCROP:7 \
ILLUMINACLIP:/data/results/adapter.fasta:2:30:8 \
LEADING:20 \
TRAILING:20 \
SLIDINGWINDOW:20:20 \
MINLEN:40
Trimmomatic manual (page #2) says that the different processing steps occur in the order in which the steps are specified on the command line. command line
Changing within the script may not be a good way, but that's how it is for now. Give it a try.
My pleasure. Just like to mention that you should upvote or accept an answer if that helped. This not only encourages the person helping you but also help other people looking for solutions to similar problems.
Hi @imesi
The post having the answer which worked should be upvoted or/and accepted as answer(you can do both). I this case if multiple posts helped, please upvote and accept as answer. In my case, that post is the one where I originally provided the link to the code.
Log in to answer this question.
-
Trimmomatic run error
written by eshrakaali_p •
-
When I run Trimmomatic, I continue to get an "unknown trimmer" error and cannot figure out how to f…
written by littlemicrobiologist •
-
How to run Trimmomatic with multiple files in a loop
written by Kumar
-
Trimmomatic - can`t find a path for to file
written by vvs.hazia •
-
Confusion about trimmomatic
written by szahid •
-
What sequences should I use for ATAC-Seq adapter trimming using trimmomatic 0.36?
written by Gary
-
error in execution of Trimmomatic 0.36
written by F.I.2011 •
-
trimmomatic Errors : "Exception in thread "main" java.lang.ArrayIndexOutOfBoundsException: 1"
written by om2021 •
-
cannot read data from simulated FASTQ files
written by anon •
-
Trimmomatic error java.io.FileNotFoundException
written by anon •
