This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Trimmomatic Error: Unable to detect quality encoding

Hi,

I am having trouble deciphering why I am getting this error using trimmomatic. I did not have this error before, so I am confused as to why it is occurring. Trimmomatic works for some of the samples, but it does not work with the rest of the samples. This is my code:

rule trim_illumina_Adaptors_fastqs:
 input: readWD + 'symlinks/{samp}_R1.fastq.gz', readWD + 'symlinks/{samp}_R2.fastq.gz', 
 output: 'symlinks/{samp}_R1.PAIREDtrimmomatictrimmed.fastq.gz', 'symlinks/{samp}_R1.UNPAIREDtrimmomatictrimmed.fastq.gz', 'symlinks/{samp}_R2.PAIREDtrimmomatictrimmed.fastq.gz', 'symlinks/{samp}_R2.UNPAIREDtrimmomatictrimmed.fastq.gz',  
 shell: 'trimmomatic PE -threads 12 -trimlog symlinks/trim_log.txt {input[0]} {input[1]} {output[0]} {output[1]} {output[2]} {output[3]} ILLUMINACLIP:/nas/longleaf/apps/trimmomatic/0.36/Trimmomatic-0.36/adapters/TruSeq3-PE.fa:2:30:10:8:TRUE LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36'

And this is my error message:

[Fri Jul 27 15:28:04 2018] rule trim_illumina_Adaptors_fastqs:
[Fri Jul 27 15:28:04 2018] input: symlinks/OM015_2014-09-10_R1.fastq.gz, symlinks/OM015_2014-09-10_R2.fastq.gz
[Fri Jul 27 15:28:04 2018] output: symlinks/OM015_2014-09-10_R1.PAIREDtrimmomatictrimmed.fastq.gz, symlinks/OM015_2014-09-10_R1.UNPAIREDtrimmomatictrimmed.fastq.gz, symlinks/OM015_2014-09-10_R2.PAIREDtrimmomatictrimmed.fastq.gz, symlinks/OM015_2014-09-10_R2.UNPAIREDtrimmomatictrimmed.fastq.gz
[Fri Jul 27 15:28:04 2018] jobid: 0
[Fri Jul 27 15:28:04 2018] wildcards: ds=OM015_2014-09-10

TrimmomaticPE: Started with arguments:
 -threads 12 -trimlog symlinks/trim_log.txt symlinks/OM015_2014-09-10_R1.fastq.gz symlinks/OM015_2014-09-10_R2.fastq.gz symlinks/OM015_2014-09-10_R1.PAIREDtrimmomatictrimmed.fastq.gz symlinks/OM015_2014-09-10_R1.UNPAIREDtrimmomatictrimmed.fastq.gz symlinks/OM015_2014-09-10_R2.PAIREDtrimmomatictrimmed.fastq.gz symlinks/OM015_2014-09-10_R2.UNPAIREDtrimmomatictrimmed.fastq.gz ILLUMINACLIP:/nas/longleaf/apps/trimmomatic/0.36/Trimmomatic-0.36/adapters/TruSeq3-PE.fa:2:30:10:8:TRUE LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
ILLUMINACLIP: Using 1 prefix pairs, 0 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Error: Unable to detect quality encoding
[Fri Jul 27 15:28:05 2018] Error in rule trim_illumina_Adaptors_fastqs:
[Fri Jul 27 15:28:05 2018] jobid: 0
[Fri Jul 27 15:28:05 2018] output: symlinks/OM015_2014-09-10_R1.PAIREDtrimmomatictrimmed.fastq.gz, symlinks/OM015_2014-09-10_R1.UNPAIREDtrimmomatictrimmed.fastq.gz, symlinks/OM015_2014-09-10_R2.PAIREDtrimmomatictrimmed.fastq.gz, symlinks/OM015_2014-09-10_R2.UNPAIREDtrimmomatictrimmed.fastq.gz

[Fri Jul 27 15:28:05 2018] RuleException:
[Fri Jul 27 15:28:05 2018] CalledProcessError in line 144 of /pine/scr/p/a/parkz/TROUBLESHOOTING/Pv_R_ASAPandCMP_3/Pv_Snaligner.py:
[Fri Jul 27 15:28:05 2018] Command ' set -euo pipefail;  trimmomatic PE -threads 12 -trimlog symlinks/trim_log.txt symlinks/OM015_2014-09-10_R1.fastq.gz symlinks/OM015_2014-09-10_R2.fastq.gz symlinks/OM015_2014-09-10_R1.PAIREDtrimmomatictrimmed.fastq.gz symlinks/OM015_2014-09-10_R1.UNPAIREDtrimmomatictrimmed.fastq.gz symlinks/OM015_2014-09-10_R2.PAIREDtrimmomatictrimmed.fastq.gz symlinks/OM015_2014-09-10_R2.UNPAIREDtrimmomatictrimmed.fastq.gz ILLUMINACLIP:/nas/longleaf/apps/trimmomatic/0.36/Trimmomatic-0.36/adapters/TruSeq3-PE.fa:2:30:10:8:TRUE LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 ' returned non-zero exit status 1.
[Fri Jul 27 15:28:05 2018] File "/pine/scr/p/a/parkz/TROUBLESHOOTING/Pv_R_ASAPandCMP_3/Pv_Snaligner.py", line 144, in __rule_trim_illumina_Adaptors_fastqs
[Fri Jul 27 15:28:05 2018] File "/proj/ideel/apps/linuxbrew/opt/python/lib/python3.7/concurrent/futures/thread.py", line 57, in run
[Fri Jul 27 15:28:05 2018] Shutting down, this might take some time.
[Fri Jul 27 15:28:05 2018] Exiting because a job execution failed. Look above for error message

This seems to be the problem:

Error: Unable to detect quality encoding

But I am unable to diagnose the problem with my limited background in coding.

Whether I send the script off as a job on the cluster or I modify the script and run it on the command line, I still get the same error.

Does anyone have any suggestions?

Thank you!

alignment genome sequencing next-gen
• 8,055 views • link
updated by h.mon h.mon • written by zackarypark • zackarypark

Hello,

could you please post the fastq data for the first few reads? We should check how the quality values look like.

fin swimmer

• 0 views • link
written by finswimmer finswimmer

1 answer

Trimmomatic uses the first few thousand reads to guess the Phred encoding of the file, looking for unique characters from the Phred+33 or Phred+64 set. If it can't find, it will throw this error. You can pass the encoding on the command-line with the parameters -phred33 or -phred64.

• 0 views • link
written by h.mon h.mon

Log in to answer this question.

More posts like this