count and compare microRNA expression value in RNA-Seq data on Galaxy

Hello,

I have a question, I want to count and compare specific MicroRNA expression value in BAM alignment on Galaxy server, How do I that? thanks in advance

rna-seq microrna dge fastq galaxy

• 1,792 views • link

written 8.1 years ago by lkianmehr

Please post Galaxy related questions over at Galaxy Biostars.

• 1 views • link

written 8.1 years ago by GenoMax

ok, I didn't know! thank you!

• 1 views • link

written 8.1 years ago by lkianmehr

You are welcome to post them here but you are likely to get prompt/better support over at the Galaxy biostar site.

• 1 views • link

written 8.1 years ago by GenoMax

0 answers

No answers yet.

More posts like this

Generating barplot of fpkm value
written 5.8 years ago by sidrah.maryam •

Hello, I want to generate a barplot of fpkm value count, for specific genes, to have finally the graph showing, which cells have high expression …
How to get proportion of specific sequence in fastq file
written 7.5 years ago by lkianmehr

Hello, Do you have any idea about How to get proportion of specific sequence (defined as a separate fastq file= ``` @1 TAACCCTAACCCTAACCCTAACCC + JJJJJJJJJJJJJJJJJJJJJJJJ …
how specify feature type in featureCounts
written 7.8 years ago by lkianmehr

Hello, I would appreciate if let me know how is better to specify feature type of featureCounts. actually I am not sure about that, because …
how merge the gene expression value of two sample
written 7.9 years ago by lkianmehr

Hello, I need your help to resolve this question, maybe is easy but I am new about it. I would be appreciated if give me …
comparision pairwise samples with DESeq2
written 8.0 years ago by lkianmehr

Hello I need your help to resolve this problem with DESeq2 because It's my first experience with DESeq2! I have read other related posts, but …
why genome format is unspecified in Galaxy server?
written 8.2 years ago by lkianmehr

Hello guys I have a problem with choosing data in Galaxy, I am faced with this error: Must be of datatype "fastqsanger" or "fasta", need …
how can I compare two samples of RNA-seq Generally
written 8.3 years ago by lkianmehr

Hi I have a general question. what should I do if I want to compare two samples of RNA-seq generally? thanks in advance Leila
How can I Annotate my miRNA data against MirBase?
written 9.2 years ago by k.kathirvel93

Hi All, Can anyone help? How can I annotate my microRNA data against MirBase. Initially, my microRNA data were mapped against the reference genome by …
RNA-seq data comparison across experiments
written 11.8 years ago by Afrodite •

Hello everybody, just a simple question: How reliable statistically or biologically would be to compare RPKM expression values from different species, experiments, data sources? And …
How To Find Snps And Mutations In Galaxy
written 13.7 years ago by KS

<p>HI,</p> <p>I have RNA-Seq data from cancer tumor sample and two reference normal sample and I want to find out SNPs and mutations in my …