count and compare microRNA expression value in RNA-Seq data on Galaxy
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
Generating barplot of fpkm value
written by sidrah.maryam 7Hello, I want to generate a barplot of fpkm value count, for specific genes, to have finally the graph showing, which cells have high expression …
-
How to get proportion of specific sequence in fastq file
written by lkianmehr 10Hello, Do you have any idea about How to get proportion of specific sequence (defined as a separate fastq file= ``` @1 TAACCCTAACCCTAACCCTAACCC + JJJJJJJJJJJJJJJJJJJJJJJJ …
-
how specify feature type in featureCounts
written by lkianmehr 10Hello, I would appreciate if let me know how is better to specify feature type of featureCounts. actually I am not sure about that, because …
-
how merge the gene expression value of two sample
written by lkianmehr 10Hello, I need your help to resolve this question, maybe is easy but I am new about it. I would be appreciated if give me …
-
comparision pairwise samples with DESeq2
written by lkianmehr 10Hello I need your help to resolve this problem with DESeq2 because It's my first experience with DESeq2! I have read other related posts, but …
-
why genome format is unspecified in Galaxy server?
written by lkianmehr 10Hello guys I have a problem with choosing data in Galaxy, I am faced with this error: Must be of datatype "fastqsanger" or "fasta", need …
-
how can I compare two samples of RNA-seq Generally
written by lkianmehr 10Hi I have a general question. what should I do if I want to compare two samples of RNA-seq generally? thanks in advance Leila
-
Calculate enrichment and abundance of miRNA from RNA-seq result
written by PDCD4 0Hello, first time poster. I am a biology student and a newbie in bioinformatics. I have the results from small RNA-seq to compare miRNA expression …
-
How can I Annotate my miRNA data against MirBase?
written by k.kathirvel93 31Hi All, Can anyone help? How can I annotate my microRNA data against MirBase. Initially, my microRNA data were mapped against the reference genome by …
-
RNA-seq data comparison across experiments
written by Afrodite 4Hello everybody, just a simple question: How reliable statistically or biologically would be to compare RPKM expression values from different species, experiments, data sources? And …
Please post
Galaxyrelated questions over at Galaxy Biostars.ok, I didn't know! thank you!
You are welcome to post them here but you are likely to get prompt/better support over at the Galaxy biostar site.