This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How to extract forward and reverse primer coordinates for soft clipping?

Hello,

I have a list of forward and reverse primers for ~400 amplicons and I want to extract the start and end coordinates of both the primers for soft clipping. Is there a way to do this?

I checked Insilco PCR. It does not provide the coordinates for primers!

Thanks!

next-gen

I want to extract the start and end coordinates of both the primers for soft clipping.

Soft clipping in what? NGS data? You could use a scan/trim program like bbduk.sh from BBMap to trim your data.

Yes NGS data. Thanks, I will check the BBmap!

2 answers

The genomecomb package developed in our department has cg primercheck which does just that. In addition, it also reports SNPs in your primers and their frequency.

Hi WouterDeCoster,

I checked the cg primercheck page you shared. It gives the coordinates of the amplicons which will be amplified. I want the start and end position of the primers itself.

ThankS!!

Hi bioinfo89,

If I'm not mistaken the output contains the following columns:

  • chromosome
  • begin
  • end
  • name
  • outer_begin
  • outer_end
  • ...

The primers binding sites are between outer_begin and begin, and end and outer_end.

Yes you are right @WouterDeCoster. I tried the tool but I get "Main target not found (no amplicon with full primer match)" when I run it.

I used the following command:

./cg primercheck amplicon_coords.bed hg38/

I also downloaded the databases recommended. refdb and refdb_cadd.

I am not sure what am I doing wrong.

Could you share a primer pair for which you got that error? Then I can try it on my system.

Ok Sure!

Forward primer AGGATTCAGAGTAAAATCAAAGTGT
Reverse primer GATGATAGGTGGTACATGCACAG

Hi bioinfo89,

Those seem to work for me. Your input should be like below, tab separated:

Which returns:

Yes @WouterDeCoster it worked thanks!

Hello,

you could use BLAT Search.

Keep in mind, if blasting against the whole reference genome, there could be more than one result for each sequence. So as may be the case you have to filter your result (e.g. based on the Score)

fin swimmer

Thanks fin swimmer, that helped! But it doesn't take primer sequences <20nt, so some prime sequences were neglected.

Hello bioinfo89,

as genomax said it's a better idea to trim your data using the adapter trimming function from bbduk.

fin swimmer

Yes, I am using adapter trimmed data!

Hello bioinfo89,

the idea was using bbduk to remove your primer sequences from your reads and not just the adapters. So if you already removed your adapters trimm your data a second time using bbduk and provide a "adapter file" containing the sequences of your primers.

fin swimmer

Log in to answer this question.