Thanks a lot @igor :)
Finding hg19 coordinates for primers to make BED file
Hello everyone!
As title suggests, I have designed primers for a gene (BRCA1) with help of ExonPrimer using hg19 as template. Problem is that in order to make manifest file in Illumina Experiment Manager (IEM) for PCR Amplicon Workflow, I need to have hg19 start and end co-ordinates of my amplicons but I have not been suplied this bit of information. So, is there any way of getting co-ordinates with help of forward and reverse primer sequences?
For Example, I have been supplied this bit of information for exon1 of BRCA1 gene,
Assembly Feb. 2009 (GRCh.37/hg19)
UCSC ID uc002icq.3
RefSeq (Accession#) NM_007294
Description Homo sapiens breast cancer 1, early onset (BRCA1), transcript variant 1, mRNA
Link: http://genome.ucsc.edu/cgi-bin/hgGene?hgg_gene=uc002icq.3&hgg_prot=P38398&hgg_chrom=chr17&hgg_start=41196311&hgg_end=41277500&hgg_type=knownGene&db=hg19&hgsid=465092029_PO9baMwFwF3f1U3frs2NPFn2sAJL
Transcript (Including UTRs) Position: chr17:41,196,312-41,277,500 Size: 81,189 Total Exon Count: 23
Coding Region Position: chr17:41,197,695-41,276,113 Size: 78,419 Coding Exon Count: 22
Codon Exon Size Product Size Start (left) End (Right) Forward Primer Reverse Primer
2 80 bp 832 2223 3054 GGACGTTGTCATTAGTTCTTTGG caacatctgcctcctggttc
• 4,950 views
•
link
1 answer
The easiest way (if you only have a few sequences) to convert from primers to coordinates is to use UCSC In-Silico PCR: http://genome.ucsc.edu/cgi-bin/hgPcr
• 0 views
•
link
• 0 views
•
link
Log in to answer this question.
How many primers do you have? If you only have a few then you could just blast them online.
Hi,
I have a similar query!! I have forward and reverse primers for 400 amplicons and I want to extract the start and end coordinates of the primers to soft clip them. Is there a way to do this?
I checked Insilco PCR. It does not provide the coordinates for primers!
Thanks!
Please use
ADD COMMENTorADD REPLYto answer to previous reactions, as such this thread remains logically structured and easy to follow. I have now moved your reaction but as you can see it's not optimal. Adding an answer should only be used for providing a solution to the question asked.This might be more appropriate as a separate question.