This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Error in TRinity

I downloaded the fastq files from EBI ENA and then ran TRinity on them. Following error is shown

Error, not recognizing read name formatting: [SRR1188607.1]

The files appear like this

@SRR1188607.1 HWI-ST915_0064:2:1101:1420:2104/1 GTCTCTTCGCACGCTTTCACTGTGAACGGTTCGGCATCGAGAAGGACGCAGTTCCTCTCCGGCTTGGACCAGTTTCTGGTGGCCACGGCTGCCCCCATCC + HDHHHHHHHHHHHHHHHHHHHHHHGHHHHHHHHHHHHHHFHFFHHHHHHHHEHEHHHHHHHGHHHED?EE=A@BACDDECCE@DB74?############ How to fix this issue

trinity error in fastaq header
• 3,233 views • link
updated by GenoMax GenoMax • written by majeedaasim • majeedaasim

Can it be another read has the same name?

• 0 views • link
written by Yang • Yang

Since your reaction is not an answer, but rather a question for more information, I have moved this to a comment for now.

• 0 views • link
written by WouterDeCoster WouterDeCoster

Another read is having the name as

@SRR1188607.1 HWI-ST915_0064:2:1101:1420:2104/2 CAAGGAGACGCTCCATTGTTGAGACGTAGCCCTTGAGGACGTCCTCGTAGGGAATCTTGTCCTCGCAGGGTGCGAAGAAGGTGATGGTGG + HHHHHHHHHHHHHHHHHEFGDEHFHHHHHCHHHFFHHHEHGEHHHFEBDEHHHHFHHHHHHHHHHHFHHF=EFFEFHEFFGDFEBFCAFD

• 0 views • link
written by majeedaasim • majeedaasim

If you want to use fastq-dump then in addition to the command options @toralmanvar provided you should use -F to restore original Illumina headers. This will remove SRR1188607.1 from fastq headers, which is what Trinity is complaining about.

• 0 views • link
written by GenoMax GenoMax

1 answer

SRR1188607 is a paired-end data so you should get 2 files after converting .sra file to fastq. If this is not the case, then please rerun fastqdump. Command which I use for PE data is :

fastq-dump -I --split-files input_file.sra

Give a try.

• 0 views • link
updated by GenoMax GenoMax • written by Tm Tm

This will likely cause the same problem as the original issue since this command will not recover original Illumina fasta headers which appears to be what Trinity is complaining about.

• 0 views • link
written by GenoMax GenoMax

Log in to answer this question.

More posts like this