This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Uniquly aligned reads by BWA-mem (MAPQ, and XA tag)

I'm trying to filter out reads that were primarily aligned to one genomic region (if a read has secondary alignment I want to keep the primary). I've tried to do this with two methods- (i) filter out reads with MAPQ=0, which should have been aligned to more than one region. (ii) read with XA tag which should indicate alternative hits. However, there are read with MAPQ 0 but without XA tag (example 1) and reads with MAPQ>0 with XA tag.

Example 1- MAPQ 0 but without XA tag SRR1338241.3 83 chr5 11625 0 76M = 11507 -194 CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCT #####################################?8:8:BD?:EC8)9DEF?AB?<a++28ddd??d3dd?<? nm:i:0="" md:z:76="" as:i:76="" xs:i:76<="" p="">

Example 2- MAPQ>0 with XA tag SRR1338241.239 99 chr1 14643 25 76M = 14706 139 GTCAGAGCAATGGCCCAAGTCTGGGTCTGGGGGGGAAGGTGTCATGGAGCCCCCTACGATTCCCAGTCGTCCTCGT C@CFFFFFHHHHHIIIJJJFHIJJJEGGJJJJJDBDDDD8@CDDEDDDDCBDDDDDDDDDDDEDDDDDDBDDDDDD NM:i:1 MD:Z:10C65 AS:i:71 XS:i:71 XA:Z:chr9,+14754,76M,1;chr15,-102516447,76M,2;chr16,+64329,13M1I62M,2;chr12,-90907,76M,3;chr2,-114356295,76M,3;

Does anyone has any explanation to this discrepancy? or any other suggestion to do it?

alignment next-gen
• 5,643 views • link
updated by Biostar Biostar • written by biobiu biobiu

Can you give your command line you used ?

• 0 views • link
written by Titus Titus

For mapping? bwa-0.7.12/bwa mem -t 16 hg19.bwa_index/hg19 file_1.fastq file_2.fastq > file.sam 2> file.log‏ Thanks

• 0 views • link
written by biobiu biobiu

Thanks. No its before filtering. My problem is not that I have technical problem to filter it out (which can be done easily by awk or grep), my problem is that I'm actually don't understand how it make sense that some reads have MAPQ 0 without XA tag and others have XA with MAPQ greater than 0. So I believe that I'm missing something here, and maybe there is easier way to filter these out.

• 0 views • link
written by biobiu biobiu

If i remember correctly your second case ( XA with MAPQ greater than 0 ) you can detect homologous genes with. For the MAPQ 0 in general it's low complexity region like in your example. So it's interesting if you work on this type of problematic ? (May be i m wrong ^^ )

• 0 views • link
written by Titus Titus

Maybe, but since I have to know that my read were mapped correctly I have to filter these cases out.

• 0 views • link
written by biobiu biobiu

0 answers

No answers yet.

Log in to answer this question.

More posts like this