This is a test version of Biostars. For the public version, visit https://www.biostars.org.
BWA 0.7.12 and Unique reads, -r, -c options, XA: and SA: optional tags on SAM output,

So, I am using the following version of BWA

Program: bwa (alignment via Burrows-Wheeler transformation)
Version: 0.7.12-r1039

I got through a lot threads read answers and so on... still I am confused.

I am performing ChIP or 4C seq. I get single end reads. I would like to get uniquely mapped reads. For the 4C I am trimming the viewpoint.

This is the command I am using:

bwa mem -t 8 -M -k 19 -r 1 -c 1 $ref_genome $1/$base1".trimmed" > $3/$NOEXT1".sam"

and those are the explanation for every string I included:

  • -c keep those that have unique alignment (Discard a MEM if it has more than INT occurence in the genome. This is an insensitive parameter. [10000])
  • -r by reducing it to 1, I get bwa mem to work things out more intensively, like the --best command for bowtie (Larger value yields fewer seeds, which leads to faster alignment speed but lower accuracy)
  • -k seed length (I thing that 32 is to big????)
  • -M keep it compatible with picard tools
  • -t threads to use

What are your opinion on the -c and -r strings?

Then I get to see the produced file and it has sequences that are marked with the optional field of XA:Z and SA:Z

XA: Alternative hits; format: (chr,pos,CIGAR,NM;)

EDIT: In any case I have failed to find the XT:A:U optional flag

SA: Z, not sure what it is but, it almost always coincides with the 256 flag = not primary alignment so I believe that this is NOT a unique aligned read.

The question is mostly on XA:. There is no XA:U if it exist it is XA:Z and is followed by 3 or more genomic coordinates, and that makes me believe that this is not a uniquely mapped read.

To wrap it up I remove from the SAM file with the following:

samtools view -h -q 1 -F 4 -F 256 $3/$NOEXT1".sam" | grep -v "XA:Z" | grep -v "SA:Z" > $3/$NOEXT1"_mem.sam"
  • -F 4: remove not mapped
  • -F 256: remove not primary aligned
  • -q 1: remove reads with MAPQ quality less than 1 (I thing that this is quite necessary)

I am rephrasing.

Does anyone have any info our input regarding the SA: and XA: tags, especially in the absence of the XA:U tag? Does the removal of those tags makes sense or I am loosing valuable reads?

EDIT:

Here are some reads as an example:

Those include both the SA: and the XA optional flag

BIOMICS-HISEQHI:522:HCYM5ADXX:2:2115:14837:88360        16      chr12   87311997        1       34M17S  *       0       0       TCTATAAACACCTCTAAGAAAATAAACTAGAAAATCCAGATGAAATGGATA     BBBBBBABB>A<B>B>A?7BBB?A=0BBA?A?BBBBBBBA=BBBBBBBB?B     NM:i:1  MD:Z:0A33       AS:i:33 XS:i:31 SA:Z:chr2,161581931,+,32M19S,1,0;       XA:Z:chr9,-104599379,51M,5;chr3,+170653467,51M,5;
BIOMICS-HISEQHI:522:HCYM5ADXX:2:1102:3525:68438 16      chr12   87311999        0       32M17S  *       0       0       TATAAACACCTCTAAGAAAATAAACTAGAAAATCCAGATGAAATGGATA       AA==5.DB8BB8=/??*<D99D??9?D<BEBD@FDD????E<E?E<CAC       NM:i:0  MD:Z:32 AS:i:32 XS:i:30 SA:Z:chr2,161581931,+,32M17S,0,0;       XA:Z:chr9,-104599381,49M,4;chr3,+170653467,49M,4;chr12,+46991828,49M,5;
BIOMICS-HISEQHI:522:HCYM5ADXX:2:1209:6904:71888 256     chr17   59076122        0       33M18H  *       0       0       TTTTCCCATTCTGTAGATTGTCTGTTTACTCTG       IGGIIIIIIIIGA@GGGHFIIIIIFFHEIHIHF       NM:i:0  MD:Z:33 AS:i:33 XS:i:32 SA:Z:chr11,22585338,+,18S33M,0,0;       XA:Z:chr4,-151801895,19S32M,0;
(END)

Those got only the XA: optional flag

BIOMICS-HISEQHI:522:HCYM5ADXX:2:2104:11639:55952        0       chr1    8120580 1       15S31M5S        *       0       0       TCTTGGGATGGACATGTGAGCTGAAATGGCGCCATTGCACTCCAGCTTGGG     GIIIGCGFGCGHEGFHIICCGIHDD>HB<CHHGAHHIIHHEHHFFFFFEDD     NM:i:0  MD:Z:31 AS:i:31 XS:i:29 XA:Z:chr8,+98304845,30M21S,1;chr20,+51943978,23S28M,0;chr16,+70407077,14S37M,2;chr8,+55962122,15S36M,2;chrX,-70173856,26M25S,0;
BIOMICS-HISEQHI:522:HCYM5ADXX:2:2105:16548:32340        0       chr1    8120580 6       15S34M  *       0       0       CCTTGGGATGGACATGTGAGCTGAAATGGCGCCATTGCACTCCAGCCTG       HHIIHIEIBF1?DHGGDDDF<FB?BGIHI>FGI<EHC@CCHEFE>@BCC       NM:i:0  MD:Z:34 AS:i:34 XS:i:30 XA:Z:chr8,+98304845,30M19S,0;chr16,+70407077,14S35M,1;chr8,+55962122,15S34M,1;
BIOMICS-HISEQHI:522:HCYM5ADXX:2:2106:5931:90491 0       chr1    8120580 6       14S32M  *       0       0       CTTGGGATGTACATGTGAGCTGAAATGGCGCCATTGCACTCCAGCC  @H4EC381)*1*:?B:*?:0:?BD?G*?8'-<-5C4=;;D.?7A>E  NM:i:0  MD:Z:32 AS:i:32 XS:i:28 XA:Z:chr16,+70407077,13S33M,1;chr8,+55962122,14S32M,1;
BIOMICS-HISEQHI:522:HCYM5ADXX:2:2108:7261:70911 0       chr1    8120580 0       15S36M  *       0       0       TCTTGGGATGGACATGTGAGCTGAAATGGCGCCATTGCACTCCAGTCTGGG     :>33@@1(.=?1>99?3.=33.6=3:>)=;533-5=9;;3>9?;?8=?337     NM:i:2  MD:Z:30C3A1     AS:i:30 XS:i:29 XA:Z:chr8,+98304845,30M21S,1;chr1,-8936944,28M23S,0;chr16,+70407077,14S37M,2;chr8,+55962122,15S36M,2;chr10,-95309935,26M25S,0;
BIOMICS-HISEQHI:522:HCYM5ADXX:2:2113:12753:98209        0       chr1    8120580 9       15S36M  *       0       0       CCTTGGGATGGACATGTGAGCTGAAATGGCGCCATTGCACTCCAGCCTGAG     ><6)<2:86-97;3:?>?==<?>?1=?3>75;?3=?;?;=???;?==>7;>     NM:i:0  MD:Z:36 AS:i:36 XS:i:30 XA:Z:chr8,+98304845,30M21S,0;chr16,+70407077,14S37M,2;

Any help would be appreciated

bwa sam
• 28,069 views • link
updated by Ram Ram • written by theodore theodore

No one? Anyone?

• 0 views • link
updated by Ram Ram • written by theodore theodore

I will probably also post this question over to SeqAnswers

• 1 views • link
updated by Ram Ram • written by theodore theodore

Personally I find your post quite confusing, it's unclear to me what you are asking... To the question "What are your opinion on the -c and -r strings? I haven't played with them but default seems ok for my needs. "Am, I missing something, Do I do something wrong?" hard to tell without more background about your task...

• 1 views • link
updated by Ram Ram • written by dariober dariober

what would you think a proper background would be?

experiment?

propose of the analysis?

regarding the "what am I missing" question, it refers mostly to the observation of the existence of the SA:Z and XA:Z, optional flags, although I have followed the recommendations described in nummerous posts in the forums.

I could add that I have single end reads...

• 1 views • link
updated by Ram Ram • written by theodore theodore

Dear Theodore;

I am having equal difficulty filtering for uniquely aligned reads using bwa0.7.10. I simply want to extract all reads that align exactly once to the genome. In STAR, MAPQ is calculated as a function of how many times it can be potentially aligned, so I can simply filter based on that. I'm not sure what strategy is appropriate for bwa, where MAPQ is calculated differently. Would outputing only the highest alignments do the trick? I am hoping you have made progress on this front.

Regards,
Julien

• 0 views • link
updated by Ram Ram • written by jrichardalbert • jrichardalbert

do you have figured out the question to extract all reads that align exactly once to the genome successfully ?

• 1 views • link
written by winter_li • winter_li

if I am not mistaken the following as noted above should do it

try to map with:

bwa mem -t 8 -M -k 19 -r 1 -c 1

and then from the sam file, before converting it to bam do:

samtools view -h -q 1 -F 4 -F 256 $3/$NOEXT1".sam" | grep -v "XA:Z" | grep -v "SA:Z" > $3/$NOEXT1"_mem.sam"

the -F 256 applies only if the -M has been used during mapping

I hope that it helps

• 1 views • link
updated by Ram Ram • written by theodore theodore

2 answers

Not sure whether I understood your original question, but in case what you're asking is "what do the XA and SA flags mean" this is what bwa announced:

Release 0.7.5 (29 May, 2013):

  • Other hits part of a chimeric alignment are now reported in the SA tag, conforming to the SAM spec v1.5. (See also SAM format specifications)

Release 0.7.9 (19 May, 2014):

  • Output alternative hits in the XA tag if there are not so many of them. This is a BWA-backtrack feature

It took me a while to figure this out as well.

• 0 views • link
updated by Ram Ram • written by Carambakaracho Carambakaracho

Copied from my reply at an another forum

For much faster and stable$ implementation, sambamba can handle this using following one-liner:

sambamba view -t 12 -h -f bam -F "mapping_quality >= 1 and not (unmapped or secondary_alignment) and not ([XA] != null or [SA] != null)" test.bwa-mem.bam -o test-uniq.bam

See manpage and sambamba synatx for filters for details on further usage.

$: Besides grep based search being slow, it may return false positive hits (@gringer's reply above). I also do not find awk based approach reliable because fields like XA, SA, etc. are optional fields in SAM format, and not positionally fixed fields.

• 1 views • link
written by Samir Samir

Log in to answer this question.

More posts like this