This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Bwa mem different alignment results for the same reference genome

I used a genome A and an A+B genome to construct two A.db and AB.db with bwa respectively. The reads can be alignment with A alone, but only the B genome is alignment in the results of AB. I used the -a parameter of bwa mem during the alignment, but why not all the alignment results are output in the result.

Input_A:

bwa mem -a A.ref.fna query.fa |samtools view -F 4 -bS|grep "NDX550718_RUO:5:HF5H7BGXK:1:11101:8944:11737|len=76"

OutPut_A:

NDX550718_RUO:5:HF5H7BGXK:1:11101:8944:11737|len=76 0   ref_A   1569869 60  76M *   0   0   ACTTAATTGTGTTAGAAGCTCTGAATTTTCAATCCAACCTAATACAGCTGGACCGATAACGATACCGACAATTAAT    *   NM:i:1  MD:Z:9A66   AS:i:71 XS:i:0

Input_AB:

bwa mem -a AB.ref.fna query.fa |samtools view -F 4 -bS |grep "NDX550718_RUO:5:HF5H7BGXK:1:11101:8944:11737|len=76"

OutPut_AB:

NDX550718_RUO:5:HF5H7BGXK:1:11101:8944:11737|len=76 0   ref_B   119652595   0   76M *   0   0   ACTTAATTGTGTTAGAAGCTCTGAATTTTCAATCCAACCTAATACAGCTGGACCGATAACGATACCGACAATTAAT    *   NM:i:0  MD:Z:76 AS:i:76 XS:i:76
NDX550718_RUO:5:HF5H7BGXK:1:11101:8944:11737|len=76 256 ref_B   33868779    0   76M *   0   0   *   *   NM:i:0  MD:Z:76 AS:i:76
NDX550718_RUO:5:HF5H7BGXK:1:11101:8944:11737|len=76 256 ref_B   96156965    0   76M *   0   0   *   *   NM:i:0  MD:Z:76 AS:i:76

genome size(bp):

ref_A      5427183
ref_B   273598709
bwa-mem

I suggest you look into the NM:i values. In ref_A is 1, in ref_B is 0. By looking at older posts it looks like the value is the edit distance between the sequence and the reference. So apparently you map exactly to ref_B and with a SNP to ref_A. This is my understanding, you may want to investigate in more detail.

0 answers

No answers yet.

Log in to answer this question.