More posts like this
-
Why protein sequence from AUGUSTUS can't find in blast
written by Jl •Hi all, I'm try to do lizard genome annotation in galaxy. I used AUGUSTUS in galaxy, use chicken as trainingset, softmasking is TRUE, "predict genes …
-
gff to GFF3 converter
written by saadleeshehreenHi, For running Proteinortho 5 I need to supply a .gff file. My .gff file is like that > NZ_FOTL01000022.1 Protein Homology CDS 284 1399 …
-
Why does my genome annotation file contain only one type of feature? (i.e. mol_type=genomic DNA)
written by molly77 •Hi, I have a gff file of a genome that I obtained from NCBI. The gff file and corresponding genome fasta come from a recently …
-
Program that will extract all CDS from protein-coding genes in a genome fasta file (with gff file)
written by molly77 •Hi, I have a genome fasta file and corresponding gff annotation file, how can I extract all CDS from all of the protein-coding genes in …
-
Removing reads based on a pattern in the sequence name
written by fufuyouHi, I have some reads like as: >seq_5150639_x4 GGAACGAGATCGTCTGCAGTTGGC >seq_5150619_x40 AACCGCCTGTAGAAATGCATGATT X4 or X40 indicate how many reads same with the read. I want to …
-
Add a sequence name!
written by fufuyouHi, I get my sequence files like this TAACAGTGGGTCGAGATAAGGAC 1 CGCCCGGACGTCAGAGAAAAAGGTGCCAGCGCGGCGCAGAGAATGGAATT 1 TTAGTATGACGGGCTGACACGAGA 3 I want to add a sequence name at each sequence file …
-
MiRNAkey config file!
written by fufuyouHi, I want to run miRNAkey with my own miRbase subset. It need a mirna.config file. I have tried many times. I can not get …
-
how to get the genotypes from vcf file.
written by fufuyouHi, I have a vcf files with multiple samples. I want get the genotype data from the vcf file. I do not know how to …
-
protein text format convert!
written by fufuyouHi everyone, I have some protein sequences with carriage return every line. But my program need one protein name and sequence. ![screenshot][1] Could you help …
-
samtools error file
written by fufuyouHi everyone, I use samtools for calling SNP. I running many samples with the same code. Most of samples is normal. I met some error …
It would be good if you could add some more information to your question. Based on what would you filter? The distance between begin and end has to be a minimal value? Try to be as specific as possible!
Thanks. I think it is not the distance between begin and end. I think I want to know how to set a minimal value for protein sequence or CDS. fUYOU
A minimum what? And if you aren't sure, how should we know? Maybe it's best that you first figure out what want before asking people to help you.
Thanks. I am sorry about my quesition is not clear. My mean is that I have gotten a gff files based on some predict software. But I find some genes is so short. I want to remove out these short genes. For example, I hope all genes protein sequences is more than 50 aa using this gff files. Or all genes CDS is more than 150 bp. I want to remove out some predicted genes with lower than 50 aa protein sequences. Like as following:
I want to remove out the second predicted, mrna0002.
How about:
awk '{if (($5 - $4)> 150) print $0}' your_file > new_fileAdjust150to a value that will exclude things smaller than that length.Thanks, But I think I should only do mRNA line.
If you want to only remove
mRNAline then:awk '{if (($5 - $4)> 150 || ($3 == "exon")) print $0}' your_file > new_file.If you want to only keep
mRNAline then:awk '{if (($5 - $4)> 150 || ($3 == "mRNA")) print $0}' your_file > new_fileThanks, My mean is if one gene, for example mrna0001, $5-$4 > 150 in mRNA line, I want to keep mRNA and exon line. If one gene, for example mrna0002, $5-$4 < 150 in mRNA line, I want to remove both mRNA and exon. I want to get the result is
. I think your code shoul be close what I want. I am very appreciated your help. Fuyou
Careful with the $5 -$4 thing, that's the length of mRNA in genomic coordinates ($end-$start) and this is not the same as the length of the transcript not to mention CDS. There are no annotation of CDS in your example GFF, nor UTRs. Without this information, the length of the CDS cannot be determined. In addition, there is something more that is odd:
These exons overlap, but they have the same parent transcript, but if one has a different start, they cannot both belong to the same mRNA, can they? Even if, it shows that you cannot just sum over the length of each exon for each transcript.
Could you please provide part of your file and explain the reason for such filtration of your gff file. If you used a program to predict gene models then the gene length cutoff should be set in it because it affects your statistical model. If you are trying to have only high quality predicted gene models and you assumed that short genes are potential errors, then you have to look at GO terms and see if in other species these GO terms are enriched with short genes.