This is a test version of Biostars. For the public version, visit https://www.biostars.org.
MiRNAkey config file!

Hi, I want to run miRNAkey with my own miRbase subset. It need a mirna.config file. I have tried many times. I can not get the config file. Could you send me a example of config file? Thank you very much! Fuyou

rna-seq
• 1,313 views • link
written by fufuyou fufuyou

0 answers

No answers yet.

Log in to answer this question.

More posts like this
  • Help finding GTEx v8 file
    written by 蒲蒲 • 蒲蒲
    I need to use this file GTEx_Analysis_v8_WholeGenomeSeq/GTEx_Analysis_2017-06-05_v8_WholeGenomeSeq_838Indiv_Analysis_Freeze.SHAPEIT2_phased.vcf.gz for my experiments recently, if anyone can find it, can you please send it to me, thank you …
  • Subsampling one bamfile multiple times?
    written by wjdgmlcjf • wjdgmlcjf
    Hi, I have a bam file and I want to subsample this bam file 10 times with 1x, 2x, 5x coverage each. Can anyone help …
  • Extraction sequence from other sequence
    written by fufuyou fufuyou
    Hello， I have lots of sequences from two parts: one is >seqeunce1 ATGTGTGTTGTACAACTTTGGTATATACTGTATATACC42327477R_3222148F_10594369R_21575807R_1679947F_28391165R other is >42327477R_3222148F_10594369R_21575807R_1679947F_28391165R TGTGTTGTACAACTTTGGTATATACTGTATATACC I want to get the sequence like as …
  • What input files does the software metilene accept/require to identify the DMR between groups for W…
    written by 331885030 • 331885030
    Hi everyone, I'm analyzing the WGBS data and found the software metilene could identify the DMR between groups. But I don't know what input files …
  • Add a sequence name!
    written by fufuyou fufuyou
    Hi, I get my sequence files like this TAACAGTGGGTCGAGATAAGGAC 1 CGCCCGGACGTCAGAGAAAAAGGTGCCAGCGCGGCGCAGAGAATGGAATT 1 TTAGTATGACGGGCTGACACGAGA 3 I want to add a sequence name at each sequence file …
  • BAM to map and read group file
    written by fufuyou fufuyou
    Hi, I want to use bam or sam file get such as following format file. one is map file: read tag Chr start position end …
  • how to get the genotypes from vcf file.
    written by fufuyou fufuyou
    Hi, I have a vcf files with multiple samples. I want get the genotype data from the vcf file. I do not know how to …
  • protein text format convert!
    written by fufuyou fufuyou
    Hi everyone, I have some protein sequences with carriage return every line. But my program need one protein name and sequence. ![screenshot][1] Could you help …
  • samtools error file
    written by fufuyou fufuyou
    Hi everyone, I use samtools for calling SNP. I running many samples with the same code. Most of samples is normal. I met some error …
  • PseudoPipe is very hassle to configure
    written by Kumar Kumar
    Hi, I tried [PseudoPipe][1]. It is very hassle to configure, even with its example data itself. there is no any README and Manual file to …