TruSeq RNA Library Prep Kit v2

Plz what is the difference between : TruSeq RNA Library Prep Kit v2 and TruSeq Small RNA Library Preparation Kits Our sample is Animals model (Roddent)

rna-seq rna-seq next-gen

• 1,947 views • link

written 9.7 years ago by lamlam •

RNA vs Small RNA -> google

http://www.illumina.com/techniques/sequencing/rna-sequencing/small-rna-seq.html

• 0 views • link

written 9.7 years ago by Floris Brenk

Hello lamlam!

We believe that this post does not fit the main topic of this site.

Not related to bioinformatics, ask the company

For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with.

If you disagree please tell us why in a reply below, we'll be happy to talk about it.

Cheers!

• 0 views • link

written 9.7 years ago by WouterDeCoster

0 answers

No answers yet.

More posts like this

Combining sequence result from different library prep method
written 3.8 years ago by seal •

Hi, I've been looking over some of the available data at my lab and noticed that even in the same projects, different library preparation kits …
Transcript enrichment in Illumina RNAseq
written 5.3 years ago by compuTE

Hello, I am wondering if someone could guide me or recommend me some reading material to understand what sort of enrichment (if any) can I …
Custom TruSeq-equivalent WGS library preps, for high number of smal genomes
written 6.3 years ago by William

Does anyone have experience with custom "TruSeq-equivalent WGS library preps"? Normal TruSeq library prep costs around somewhere between $300 to $150 per sample. Some providers …
Truseq Stranded Total RNA and NEBNext Ultra II Directional RNA library prep kit
written 6.9 years ago by deniz •

Hi, Has anyone try to analyze the RNA-seq data from Illumina **Truseq Stranded Total RNA** kit and **NEBNext Ultra II Directional RNA library prep** kit …
How to trim adapters from fastq having 8mer+8mer bar-code
written 8.2 years ago by rice.researcher

I generally analyze paired-end illumina platform geretaed fastq having 6mer barcode. For ex, @K00171:40:H3KJTBBXX:8:1101:20518:2020 2:N:0:CGATGT GCTGCTTCAATCCTTTCCTCTACTGTCATGTCACTTCGGGCTTTCCCCTCTTTGACATCAATAAGTTCAACTTCATAAACAAGGTCTGCCATCAATCGTTA + A,A,F<KAFKFKFKFKKFKAFAFKAKKKFKKAFKKKKKKKKAAAAKKKKKKAKKFKKKKKKKFAKFA7FFFKKKKKFKFKFKFKFKKKKKKFFKKFKKKFK For removing the adapters, I run the …
RNA-seq adaptor sequence
written 8.5 years ago by Arindam Ghosh

I was reading some papers based RNA-seq. In found these details regarding adaptor sequence used in 3 papers: 1. TruSeq RNA sample preperation kit v2, …
Trimming Adaptor in Small RNA Analysis
written 9.4 years ago by ebrahimiet •

Hi, I have new Small RNA sequencing generated by Illumina machine (Nextseq). This Small RNAseq data is generated by “TruSeq Small RNA” library preparation kit. …
Intron within the mRNA stranded-specific library
written 9.8 years ago by seta

Hi all friends, As we all know, alternative splicing survey is one of the RNA-seq applications. In the case of using "TruSeq Stranded mRNA Sample …
Detection of (novel) lnc-RNAs in 'normal' RNA-Seq data
written 10.0 years ago by aggregatibacter

Hi folks, I have several human RNA-Seq datasets (libraries prepared from total RNA using the TruSeq Stranded Total RNA kit from Illumina) that I would …
tophat library type for Illumina TruSeq RNA sample prep v2
written 10.3 years ago by acorella •

Hi, I am trying to align RNAseq reads for which the libraries were prepped with the Illumina TruSeq RNA Sample Prep v2 kit. Would this …