This is really helpful. It would be great if you could opt out of giving the allele and it would just mark non-reference cases.
• 0 views
•
link
Hi everybody, how to extract allele specific reads from bamfiles? Thanks in advance.
that was fun enough to quickly write something : https://github.com/lindenb/jvarkit/wiki/Biostar214299 The program reads your list of mutation and tries to affect the read to a SAM-ReadGroup.
$ cat positions.tsv
rotavirus 267 C SAMPLE1
rotavirus 267 G SAMPLE2
$ java -jar dist/biostar214299.jar -p positions.tsv input.bam
@HD VN:1.5 SO:coordinate
@SQ SN:rotavirus LN:1074
@RG ID:UNAFFECTED SM:UNAFFECTED LB:UNAFFECTED
@RG ID:UNMAPPED SM:UNMAPPED LB:UNMAPPED
@RG ID:SAMPLE1 SM:SAMPLE1 LB:SAMPLE1
@RG ID:SAMPLE2 SM:SAMPLE2 LB:SAMPLE2
@RG ID:AMBIGOUS SM:AMBIGOUS LB:AMBIGOUS
(...)
rotavirus_237_744_6:0:0_3:0:0_29c 163 rotavirus 237 60 70M = 675 508 ATCCGGCGTTAAATGGAAAGTTTCGGTGATCTATTAGAAATAGAAATTGGATGACTGATTCAAAAACGGT ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ MD:Z:3A19A1C1C1G31T8 RG:Z:SAMPLE1 NM:i:6 AS:i:41 XS:i:0
rotavirus_234_692_6:0:1_4:0:0_3ac 163 rotavirus 237 60 6S30M5I1M5D28M = 623 456 TTGGTAATCAGGCGTTAAATGGAAAGTTTAGCTCAGGACAACGAAATAGAAATTGGATGACTGATTCTAA ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ MD:Z:31^TATTA28 RG:Z:SAMPLE2 NM:i:10 AS:i:37 XS:i:0
rotavirus_237_777_6:0:0_7:0:0_216 99 rotavirus 237 60 70M = 708 541 ATCAGGGGTTAAATTGAAAGTTTAGCTCAGCTCTTAGACATAGAAATTGGATGACTGATTGTACAACGGT ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ MD:Z:6C7G17A5A21C2A6 RG:Z:SAMPLE1 NM:i:6 AS:i:40 XS:i:0
rotavirus_237_699_3:0:0_8:0:0_22f 163 rotavirus 237 60 70M = 650 463 ATGAGGCGTTAAATGGAAAGTTTATCTCAGCTATTAGAAATAGCAATTGGATGACTGATTCTAAAACGGT ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ MD:Z:2C21G18A26 RG:Z:SAMPLE1 NM:i:3 AS:i:57 XS:i:0
(...)
rotavirus_311_846_10:0:0_11:0:0_3d7 141 * 0 0 * * 0 0 AACTTAGATGAAGACGATCAAAACCTTAGAATGACTTTATGTTCTAAATGGCTCGACCCAAAGATGAGAG ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ RG:Z:UNMAPPED AS:i:0 XS:i:0
rotavirus_85_600_7:0:0_9:0:0_3e0 77 * 0 0 * * 0 0 AGCTGCAGTTGTTTCTGCTCCTTCAACATTAGAATTACTGGGTATTGAATATGATTCCAATGAAGTCTAT ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ RG:Z:UNMAPPED AS:i:0 XS:i:0
rotavirus_85_600_7:0:0_9:0:0_3e0 141 * 0 0 * * 0 0 TATTTCTCCTTAAGCCTGTGTTTTATTGCATCAAATCTTTTTTCAAACTGCTCATAACGAGATTTCCACT ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ RG:Z:UNMAPPED AS:i:0 XS:i:0
you can later 'split' the output using samtools view and the option -r
-r STR only include reads in read group STR [null]
This is really helpful. It would be great if you could opt out of giving the allele and it would just mark non-reference cases.
Log in to answer this question.
it sounds like a xy problem http://xyproblem.info/ what do you want to do at the end ?
I want to distinguish containing SNP reads from female parent or male parent.
Please use
ADD REPLYto answer to earlier comments, as such this thread remains logically structured and easy to follow.for example,in plants hybirds,I want to distinguish reads from female parent or male parent with SNP
what would be your input ? how do you define a deletion / insertion ? what happens if one read contains a variant carrying two mutations from both parents ?
There must be a more elegant way but I have this piece of code lying around for the mitochondrial genome. I used it to split reads from a BAM file into those supporting a Neanderthal specific base versus present-day human contaminant one:
https://github.com/grenaud/schmutzi/blob/master/splitEndoVsCont/poshap2splitbam.cpp
If no one answers and you can hack it, feel free to use it. The input .pos format is in the same directory.
I have known the SNP information about male and female,for example,12 reads containing male SNP and 8 from female of 20 reads in hybirds according to SNP.
Essentially you want the allelic ratio/count per SNP? How do you know whether the allele is from male or female?
Say a position is a G/T SNP, how do you determine G is from male and T from female or vice versa?