This is a test version of Biostars. For the public version, visit https://www.biostars.org.
What file size should I expect after fastx_clipper (original fasta file is 7.9GB)?

Hi, I am new to this field. I clipped the adaptor sequence (illumina index 4) using the following command line. After clipping, the file is about 80 MB (originally about 8 GB), I visualized the file using fasta_clipping_histogram.pl and it seems correct. My question is that is this file size usual after clipping or did I set any parameter wrong? Thanks.

$ fastx_clipper -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTAT -l 15 -c -n -v -M 10 -i SRRxxx.fasta -o SRRxxx_clipped.fasta

Clipping Adapter: GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTAT
Min. Length: 15
Non-Clipped reads - discarded.
Input: 62420301 reads.
Output: 596770 reads.
discarded 309725 too-short reads.
discarded 8900023 adapter-only reads.
discarded 52613783 non-clipped reads.
chip-seq sequencing
• 1,817 views • link
updated by Ram Ram • written by lwang536 • lwang536

2 answers

You'll want to not use the -c option, it's needlessly getting rid of most of your data.

• 1 views • link
written by Devon Ryan Devon Ryan

Is -M 10 suitable for this case? Thanks

• 1 views • link
written by lwang536 • lwang536

No. You will get better results if you use virtually anything other than FASTX-Toolkit. The best practice depends on your data and experiment, but it will never involve FASTX. Can you describe your data and experiment in more detail?

• 1 views • link
written by Brian Bushnell Brian Bushnell

Log in to answer this question.

More posts like this