Hi, I am new to this field. I clipped the adaptor sequence (illumina index 4) using the following command line. After clipping, the file is about 80 MB (originally about 8 GB), I visualized the file using fasta_clipping_histogram.pl and it seems correct. My question is that is this file size usual after clipping or did I set any parameter wrong? Thanks.
$ fastx_clipper -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTAT -l 15 -c -n -v -M 10 -i SRRxxx.fasta -o SRRxxx_clipped.fasta
Clipping Adapter: GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTAT Min. Length: 15 Non-Clipped reads - discarded. Input: 62420301 reads. Output: 596770 reads. discarded 309725 too-short reads. discarded 8900023 adapter-only reads. discarded 52613783 non-clipped reads.
0 answers
No answers yet.
Log in to answer this question.
-
Tool: New Illumina error mode, new BBTools release (39.09) to deal with it
written by Brian Bushnell
-
Mapping rate troubles
written by thomas58 •
-
Tool: Trimviz, a lightweight QC tool to assess impact of read-trimming and aligner soft-clipping
written by stuart archer •
-
chimeric assembly of a mitogenome
written by vicmansj86 •
-
Analysing circulatory small non coding RNA
written by HK •
-
What file size should I expect after fastx_clipper (original fasta file is 7.9GB)?
written by lwang536 •
-
Trimmomatic not removing all Nextera adapters or N base calls
written by James Ashmore
-
question about Clip adapter in FASTX-toolkit for small RNA
written by rob.costa1234
-
Influence of RNA-seq read splitting on the BAQ calculation in samtools mpileup
written by Manuel Landesfeind
-
microRNA Illumina Sequencing - Very low alignment rate
written by wynstep •
