hi biostar
i would like to know whether there is any java code available to find the free energy associated with the secondary structure of RNA.
thanking you
meera
1 answer
Hi Meera,
you can try:
-
RNAmute: RNA secondary structure mutation analysis tool
RNAMute is an interactive Java application that calculates the secondary structure of all single point mutations, given an RNA sequence, and organizes them into categories according to their similarity with respect to the wild type predicted structure.
-
RNAstructure is a complete package for RNA and DNA secondary structure prediction and analysis. It includes algorithms for secondary structure prediction, including facility to predict base pairing probabilities. It also can be used to predict bimolecular structures and can predict the equilibrium binding affinity of an oligonucleotide to a structured RNA target.
The RNAstructure JAVA GUI interface is a cross-platform user-freindly front-end for RNAstructure.
-
rnafold(* in Matlab)
Predict minimum free-energy secondary structure of RNA sequence
Examples: Determine the minimum free-energy secondary structure (in both bracket and matrix notation) and the energy value of the following RNA sequence:
seq = 'ACCCCCUCCUUCCUUGGAUCAAGGGGCUCAA'; [bracket, energy, matrix] = rnafold(seq);bracket
bracket = ..(((((...((....))...))))).....
I hope this helps.
Log in to answer this question.