Error Cutadapt: FASTQ file is expected to start with '@
Hello, I am trying to use cutadapt in order to remove my adaptor, but it reports:
error: Line 1 in FASTQ file is expected to start with '@', but found '\n'
The head of my file is:
@SRR1688545.1.1 1 length=28
AACTATGCCGACTAGGGATCGGGTGGTG
+SRR1688545.1.1 1 length=28
CCCFFFFFHHHHHJJJJJJJJJJHIJJJ
@SRR1688545.2.1 2 length=31
TGCCAAGGACGTTTTCATTAATCAAGAACGA
+SRR1688545.2.1 2 length=31
CCCFFFFFHHHHHJJJJJJJJJJJJJJJJJI
How to make the fastq file usable for cutadapt?
Thank you in advance
5 answers
Could be a few things, but are you sure the first line is not blank? Make sure the @ is the very first character of the file.
It's hard to tell what your file looks like from the format of your post, but the line starting "+SRR..." should not be on the same line as the sequence ("AACTA...").
Have you tried placing input file at the end of the command like
cutadapt --adapter CTGTAGGCACCATCAAT --error-rate 0.1 --minimum-length 15 --overlap 1 --output output.fastq RB.fastq
• 0 views
•
link
written
by
gangireddy
Log in to answer this question.
More posts like this
-
Phred qual error after fastq trimming
written by yad.ghavi-helm •
-
how many bp of barcode and UMI
written by yueli7
-
get the barcode file
written by yueli7
-
SRA to FASTQ problem
written by m.t.lorenc •
-
order of trimming for RNA-seq QC
written by maria2019
-
error while using cutadapt
written by KVC_bioinfo
-
cutadapt loop and paired-end reads
written by sbrown669 •
-
Cutadapt list of adapter
written by pingEde •
-
cutadapt cannot work on my fastq files
written by Jingyue •
-
Is this a bug of Cutadapt
written by zdyuan •
what the output of
head -n1 your.fastqorgunzip -c your.fastq.gz | head -n 1the output is: @SRR1688545.1.1 1 length=28
I use this dataset http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?exp=SRX793383&cmd=search&m=downloads&s=seq
thank you for your help
I'm having same error.. the output is: @SRR4042503.1.1 1 length=51 can you suggest what can be done ?
And for another fastq file it shows: "BZh91AY&SY??F?A?????????? h??]0??R$4( 8@ej]??5?$?M?Q}?ABAB???P?(@ ?" I have just uncompressed them after downloading from the databases.
what is the output of
head -n1 RB.fastq | sed -n 'l'with this sed command, you'll display all special characters (e.g. \t,\n,\r).
I am sorry but I did not see your response. the output is: @SRR1688545.1.1 1 length=28$
why there is the characters "$"?
It is the symbol for the standard line break. So far, everything seems to be OK. I thought it might be a problem with for instance a carriage return (how line breaks are coded in Windows).
Hi! I am getting the same error as noe:
cutadapt: error: Line 1 in FASTQ file is expected to start with '@', but found '\n'
However, my file was always in fastq format and was not converted from sra or any other format, so I don't think that's the issue.
head -n1 your.fastq this gives me @HS3:635:H2LMVBCXX:1:1101:3109:1994 2:N:0:ACAGTG
head -n1 RB.fastq | sed -n 'l gives me @HS3:635:H2LMVBCXX:1:1101:3109:1994 2:N:0:ACAGTG$
Any ideas?
Can you show us the command you used?
cutadapt --adapter CTGTAGGCACCATCAAT --error-rate 0.1 --minimum-length 15 --overlap 1 RB.fastq --output output.fastq
You might have the a file with non-ASCII character encoding. What is the output of the
filecommand?