This is a test version of Biostars. For the public version, visit https://www.biostars.org.
cutadapt cannot work on my fastq files

Hi,

I download .sra files from NCBI and convert them into fastq file by fastq-dump. So when I try to use cutadapt to trim my data, it shows:

cutadapt -a AGATCGGAAGAGC -o SRR1658373.trimmed.fastq SRR1658373.fastq >> trim_report.txt
Error: at line 1, expected a line starting with '+'

So I head my fastq file, it shows:

Read 47403478 spots for SRR1658373.sra
Written 47403478 spots for SRR1658373.sra
ATGCAAATGCTTCTCAGATGATGAAAACTATTAGTATAACTGCTGTTAGGGAAATGAATGAGCCTATTGATGAGATAGTATTTCA
+SRR1658373.1 HWI-ST538:365:C2NBHACXX:1:1101:7347:2000 length=100
;7;###4<@@@@@@@@@@???@@@@@@??@?@@?@???????????????????????@@@@@@@@@@@@@??@@?@@@@@@???????????=>?????
@SRR1658373.2 HWI-ST538:365:C2NBHACXX:1:1101:1485:2103 length=100
CCAATAAAGATGGCCTAAGGTGACCTTCAACCAGAAATCCCCATGTCAGTGACACGTAAAACATGACAGCACCTTCAACACAACATGCAACCCAGACCCA
+SRR1658373.2 HWI-ST538:365:C2NBHACXX:1:1101:1485:2103 length=100
CCCFFFFFHHDHFHIGHIGIAEFHJIJIIJJIIJJJJGIIJJJJJIIJIHIFHIIIHGJIJIGHGIJJIIHHGHH@D>DFDDDDDDDDDDDDDDDBDDDD

How to make the fastq file capable for cutadapt? How to edit first 2 lines of fastq file?

Thanks a lot for the help!

Best,
Ellie

sequencing rna-seq
Read 47403478 spots for SRR1658373.sra
Written 47403478 spots for SRR1658373.sra​

Are these a part of your fastq files ? can you show the fastq-dump command ?

Thanks for the quick answer, here is my command for download files from NCBI:

/Users/ellie/sratoolkit.2.5.2-mac64/bin/prefetch SRR1658373

Then I upload SRR1658373 to a server, then did the fastq-dump by using:

/opt/sratoolkit.2.3.5-2-centos_linux64/bin/fastq-dump.2.3.5.2 SRR1658373.sra > SRR1658373.fastq

Will the different version of sratoolkit causes this problem?

1 answer

while running fastq-dump, you don't need to redirect the output. remove the > from your command. Just run

fastq-dump SRR1658373.sra

Read the documentation once and use appropriate options for your data.

Thanks a lot! Now fastq files are right:)

Log in to answer this question.