Job: $500 project - San Diego - Database design

I need a very simple database designed for a website of mine.

Base on excel, I hear it'll only take a few hours.

Can someone in San Diego help me?

Thank you very much!

Zia

database

• 70 views • link

updated 3.3 years ago by Ram

• written 10.5 years ago by dannyziajoseph •

This isn't Craigslist.

• 0 views • link

written 10.5 years ago by John

0 answers

No answers yet.

More posts like this

Could someone send me CISA software ?
written 1.7 years ago by lu_baicheng •

Could someone send me CISA software? I could not download CISA from website (http://sb.nhri.org.tw/CISA). Thank you very much.
Absolute Beginner Tutorial for SSRs markers database creation
written 6.8 years ago by angez9914 •

Dear all, I successfully retrieved SSRs data from multiple genome sequences. I would like to create a dynamic database for SSRs markers using LAMP (linux …
Find all perfect matches for short sequences to human reference genome
written 7.0 years ago by Mick •

Hi guys, I'm trying to get something done that sound super simple but I'm stuck and I don't know how to go about it. I …
Python code for extracting values from an Excel database?
written 7.3 years ago by d.awwad19 •

Hello.. I have a big database in an Excel format (around 50,000 records) of sequence accession codes and corresponding numerical values, and I need a …
crispr mageck analysis ,Sam library
written 8.7 years ago by 11yj3312 •

Dear all， I download SAM Library from website，but there is only guide sequence and gene-number,like this: NM_000014_1 AAGTGAGCTCTTACGGGAAT NM_000014 NM_000014_2 GAATGTAGTTTTAGCCCTCC NM_000014 NM_000014_3 GGGATTCTATTTAGCCCGCC NM_000014 …
Questions about BreakDancer
written 10.6 years ago by hxlei613

I find that Breakdancer is designed to detect SVs. But there are many people saying that it can be used to detect CNV. I get …
How to select checkbox with specific names on web page (the TCGA data)
written 11.2 years ago by Xinsen Xu •

Hi, I want to download the RNA-seq data from the TCGA website. After I built the data matrix on the TCGA website, there are hundreds …
Forum: Survey for my final year project - Identify inherited diseases based on DNA related data
written 11.8 years ago by lmanohara99 •

Hello all, Please spend a few minutes of your time to fill this questionnaire of mine. This is only for educational purpose. I really appreciate …
Command Line Program For Constructing Phylogeny Tree In Minutes (500 Sequences)?
written 12.7 years ago by onpelikan •

<p>Hi, can you help me please with choosing the command line program/tool which is able to construct phylogenetic tree from 500 sequences in few minutes …
Plot table with all replicates in cuffdiff output with cummeRbund
written 12.9 years ago by sindrelee •

Hi Can someone help to do the following from the *cummeRbund* package: I only want to plot a simple table by tweaking this command: gl.iso.rep<-expressionPlot(isoforms(myGene),replicates=T) …