Biostar Beta. Not for public use.
crispr mageck analysis ,Sam library
0
Entering edit mode
10 months ago
11yj3312 • 0

Dear all, I download SAM Library from website,but there is only guide sequence and gene-number,like this:

NM_000014_1    AAGTGAGCTCTTACGGGAAT    NM_000014
NM_000014_2    GAATGTAGTTTTAGCCCTCC    NM_000014
NM_000014_3    GGGATTCTATTTAGCCCGCC    NM_000014

how can i kown the gene_id of each sgRNA,or someone have the library file? Thank you very much for any help. Jing Yu

ADD COMMENTlink
1
Entering edit mode
ADD REPLYlink

Login before adding your answer.

Similar Posts
Loading Similar Posts
Powered by the version 2.1