This is a test version of Biostars. For the public version, visit https://www.biostars.org.
crispr mageck analysis ,Sam library

Dear all, I download SAM Library from website,but there is only guide sequence and gene-number,like this:

NM_000014_1    AAGTGAGCTCTTACGGGAAT    NM_000014
NM_000014_2    GAATGTAGTTTTAGCCCTCC    NM_000014
NM_000014_3    GGGATTCTATTTAGCCCGCC    NM_000014

how can i kown the gene_id of each sgRNA,or someone have the library file? Thank you very much for any help. Jing Yu

genome crispr library sam

0 answers

No answers yet.

Log in to answer this question.