crispr mageck analysis ,Sam library

Question

[11yj3312]

Dear all， I download SAM Library from website，but there is only guide sequence and gene-number,like this:

NM_000014_1    AAGTGAGCTCTTACGGGAAT    NM_000014
NM_000014_2    GAATGTAGTTTTAGCCCTCC    NM_000014
NM_000014_3    GGGATTCTATTTAGCCCGCC    NM_000014

how can i kown the gene_id of each sgRNA,or someone have the library file? Thank you very much for any help. Jing Yu

[Pierre Lindenbaum]

see Convert Refseq Id To Gene Name