Hi,

I am working with the flanking regions of microsatellites for a coral (no reference genome). I sequenced the microsatellites and then split the flanking regions from the tandem repeats. I now want to look for SNPs in these flanking regions. I am working with a large dataset: 25 sites with 48 individuals that were sequenced at 12 loci each.

1. Is DiscoSNP++ the right program to do this?
2. What format/information do the sequence need to have in the input file? I did a trial run with a unique read set with a unique read file but it didn't find any SNPs:

#Disco2_test
>S10_C10_1_a1
ATGTGAGAAAGCTAATCCATTTTTAAT
>S10_C11_1_a1
ATGTGAGAAAGCTAATCCATTTCTGCTTAAT
>S10_C12_1_a1
ATGTGAGAAAGCTAATCCATTTTTAAT
>S10_C13_1_a1
ACGTGAGAAAGCTAATCCATTTTTAAT

fof_test.txt: data_test/test_Disco2.fasta

Results seem to show no polymorphism. Do I need to process the sequences before creating the files? In the example each sequence has information linked to it such as indel position which I don't have.

Thank you,
Annick