This is a test version of Biostars. For the public version, visit https://www.biostars.org.
how to design primers for IKBKG gene if it has pseudo gene?
Hi every one, I'm trying to design primers for IKBKG gene exon wise. Covering each exon region separately. But from exon 3 to 10 region its is having pesudo gene. I want primers specific to this target region not pseudo gene. How to design primers in this case. Hope to hear from you Thanks
primerdesign

1 answer

Pseudo genes, as paralogues (defined on protein sequence similarity), are not necessarily a problem, only the level of DNA sequence identity is important. Do a full DNA-DNA alignment of the coding sequences and try to design primers using the sequences that are divergent enough, by specifying those unique regions as input to your primer designer. Do an in-silico PCR with the designed primers to detect other non-specific sites.

In eprimer3, parameters

-targetregion, -excludedregion, -includedregion can be used to control this.

The -mispriminglibraryfile parameter could be used to input sequences to avoid for amplification e.g. the coding sequence of the pseudogene.

Use -explain parameter to get an explanation in case no primer pair can be found.

IKBKG gene (exon 3 to exon 10) has pseudo gene. I have done blast and compared sequence but there is no chance of primer design specific to target region.

for example these primers covering IKBKG gene (exon 3 to exon 10) has pseudo gene. how to solve these issue and to design unique primers.

need help

  • AAGGGAGTGTTGAGACGCCATC
  • ACTGCATGGCCTAGCGAATGAC

thanks

What's the sequence identity at DNA level?

done similarity with blast, Sequence identity is 99%

hey I got specific primers for these sequence covering 1,2,3-10 exons not exon wise its was tough

how to design primers for mrna coding region of the same sequence. covering UTR also or without UTRs

thanks

Log in to answer this question.