This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Error Runnin miRDeep2

Hi All

I am trying to run miRDeep2 for the differential expression of miRNA in my dataset. I ran the mapper.pl without much hassle. However, I can't get the miRDeep2.pl to run and keep getting errors:

Here's the error that I am getting:

Error: problem with /data/lab/Homo_sapiens/Ensembl/GRCh37/Sequence/BowtieIndex/new_genome.fa

Error in line 9.221.351: The sequence
CCRRGCTTGGTTCTAACAATGAATTTAATAAGAATTGTATTTAATCAATGTTTAAATATA
contains characters others than [acgtnACGTN]

Please check your file for the following issues:

I. Sequences are allowed only to comprise characters [ACGTNacgtn].
II. Identifiers are not allowed to have withespaces.

I got the error before for a nucleotide M in another sequence within the genome.fa file. I replaced it with N manually. However, it's showing me error with another sequence. Is there a way to get around this? Maybe I am missing something. Any help is appreciated.

Here's my command that I used to run the program:

miRDeep2.pl \
  ABC.clipped_collapsed.fa \
  /data/lab/Homo_sapiens/Ensembl/GRCh37/Sequence/BowtieIndex/new_genome.fa \
  ABC.clipped_collapsed.arf \
  /data/lab/Homo_sapiens/Ensembl/GRCh37/Annotation/SmallRNA/new_mature.fa none \
  /data/lab/Homo_sapiens/Ensembl/GRCh37/Annotation/SmallRNA/new_precursor.fa
microrna mirdeep2 sequencing
• 4,111 views • link
updated by Ram Ram • written by pm2012 pm2012

1 answer

Did you fix this yet? It says your sequence contains R's. I got the same problem. I simply opened my genome in a text editor and searched for all characters besides AGCTN and replaced them with N. I only had two W's though.

• 1 views • link
written by jon.brate jon.brate

Hi jon.brate

I am new to NGS. I got the same error as above and i am trying to do as you said. But i have a doubt. should i delete all the characters besides ACGTNacgtn? For eg: This is one of the mirna. Here you can see 'b'. Should that character be also removed?

hsa-miR-125b-1-3p ACGGGUUAGGCUCUUGGGAGCU

Thanking You in advance

• 0 views • link
written by nivya.james2016 • nivya.james2016

Sorry for the late answer, I am not sure I understand your problem. My error was about the reference genome, not the miRNAs. And I am not sure which 'b' character you refer to, the one in the miRNA name?

• 1 views • link
written by jon.brate jon.brate

Log in to answer this question.

More posts like this