This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Error in miRDeep2

Respected all,

I am working with miRNA data. Currently, I am facing the following issues in the genome.fa file. Please look at it and give your valuable comments to solve the error

Thanks

Error: problem with genome.fa Error in line 6.618: The sequence

TCAAATACTGAAAAATATTTCACAGCATTCTCATATTTGTGGTGAATTTTCAGAAGCTTR

contains characters others than [acgtnACGTN]

Please check your file for the following issues:

I. Sequences are allowed only to comprise characters [ACGTNacgtn]. II. Identifiers are not allowed to have withespaces.

mirdeep2
• 1,519 views • link
written by kuttibiotech2009 • kuttibiotech2009

1 answer

Your sequence contains an R which isn't allowed.

• 0 views • link
written by Jack Tierney • Jack Tierney

Hello jack Tierney Thanks for your comment.. After replacing N with R it's working fine... I have posted another one question...please look at it and give your suggestions it will help me a lot

• 0 views • link
written by kuttibiotech2009 • kuttibiotech2009

Log in to answer this question.

More posts like this