This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Accurate position for a gene

Excuse me:

How do I know the exact position (format: chr***:***-***,not like 2q22-q23) for a gene?

Many thanks in advance!

gene sequence next-gen-sequencing
• 1,882 views • link
updated by Ram Ram • written by 897598644 897598644

1 answer

https://genome.ucsc.edu/

OR You can also download gtf file (http://www.ensembl.org/info/data/ftp/index.html) for your organism of interest. This file contains genes and their start and end positions.

• 0 views • link
updated by Ram Ram • written by Ashutosh Pandey Ashutosh Pandey

Or even biomart, for a list of genes.

• 0 views • link
written by Devon Ryan Devon Ryan

Log in to answer this question.

More posts like this
  • Forum: How to find the distance from one variant to 5' UTR and 3' UTR
    written by 897598644 897598644
    Excuse me, I want to know how many bases there are from one variant to 5' UTR and 3' UTR. Are there any step-by-step instructions …
  • gene transfer format in UCSC download
    written by 897598644 897598644
    Excuse me: The gene transfer format is 1-based, as is introduced in some forums like biostar. But https://genome.ucsc.edu/FAQ/FAQtracks.html said that any database file downloading from …
  • Gene in ncbi
    written by 897598644 897598644
    Excuse me: When I entered a gene name in ncbi search engine (http://www.ncbi.nlm.nih.gov/gene/2972) and click the 'GenBank' button, it displayed different names of genes. So …
  • How to count repeated sequences in fasta file?
    written by 897598644 897598644
    Excuse me : For a sequencing data, how to count repeated sequences in fasta file? Many thanks in advance!
  • Exon count in ncbi
    written by 897598644 897598644
    Excuse me : There is exon count term in gene item of NCBI. I was wondering why it is not equal to the number of …
  • Sample order in vcf
    written by 897598644 897598644
    Excuse me: I used HC (haplotype caller) to call variants to create variant format file. The sample order in HC was not the same as …
  • Recurrent de novo mutation
    written by 897598644 897598644
    Excuse me: I want to know the exact definition of recurrent de novo mutation. But wiki did show that. Any link or paper related with …
  • Bedtools output fasta format files？
    written by 897598644 897598644
    Excuse me: After I got sequences with command: `bedtools/fastaFromBed -fi /ucsc.hg19.fasta -bed /range.bed -fo /range.out.fasta`, the output file is like: ``` >chr2:200172828-200174428 AGTGTCAGTAGTTAAACTCAATT ``` I …
  • base and genotype at the same position
    written by 897598644 897598644
    Excuse me: As with the variant,base and genotype at the same position are hand in hand. So what is the relation. For example, could we …
  • variant call format
    written by 897598644 897598644
    Excuse me: In the variant call format v4.1,one example showed the variant result as follows: ref:G, alt: A, NA00001:0|0,NA00002:1|0,NA00003:1/1 Every snp position of variants is …