More posts like this
-
Forum: How to find the distance from one variant to 5' UTR and 3' UTR
written by 897598644Excuse me, I want to know how many bases there are from one variant to 5' UTR and 3' UTR. Are there any step-by-step instructions …
-
Exon count in ncbi
written by 897598644Excuse me : There is exon count term in gene item of NCBI. I was wondering why it is not equal to the number of …
-
samtools variant calling
written by 897598644Excuse me : After calling variants with samtools and bcftools, I got vcf file. Could I recalibrate the variants using VQSR procedure? Is it practicable? …
-
File size through VariantRecalibration step
written by 897598644Excuse me : Would the file size become larger or smaller through the VariantRecalibration step? Many thanks in advance!
-
Accurate position for a gene
written by 897598644Excuse me: How do I know the exact position (format: `chr***:***-***`,not like `2q22-q23`) for a gene? Many thanks in advance!
-
Bedtools output fasta format files?
written by 897598644Excuse me: After I got sequences with command: `bedtools/fastaFromBed -fi /ucsc.hg19.fasta -bed /range.bed -fo /range.out.fasta`, the output file is like: ``` >chr2:200172828-200174428 AGTGTCAGTAGTTAAACTCAATT ``` I …
-
Term of throughput in next generation sequencing
written by 897598644Excuse me: How shou'd I understand the concept of throughput? Does it mean the length of read or the output data amount or the speed …
-
Paired end sequencing and single end sequencing in next generation sequencing of Illumina platform
written by 897598644Excuse me: Is there any paper that introduces the procedure of paired end sequencing and single end sequencing in next generation sequencing of Illumina platform? …
-
gene function in refgene when using annovar
written by 897598644Excuse me: My NGS data is whole exome sequencing data. After calling variants, I annotated variants with refGene using annovar. In the column `Func.refGene`, there …
-
how to identify a sequencing sample's gender
written by 897598644excuse me: could you tell me how to identify a sequencing sample's gender? Being a greenhand, i would appreciate if you give me detailed procedures. …
Hello 897598644!
We believe that this post does not fit the main topic of this site.This question has been addressed a lot of times. Please search the forum with the terms "fasta duplicate".
For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with.
If you disagree please tell us why in a reply below, we'll be happy to talk about it.
Cheers!
Addressed a lot of times? Oh really? So why am I still looking for similar question, what is more question which is answered already...
Hmmm if you can parse your fasta file into tab separated table, I mean column 1 - ID column 2 - sequence. You can count duplicated sequences in very easy way in R:
where 'seq' is name of column which contains sequences.
This commands will print sequence and it's frequency in fasta file.
I'm sure, that is some tool which can count repeats in fasta file without any convertion but I don't know any of them.
Maybe I would, but question is closed :x
Counting repeats isn't as much as popular as duplicates removal from fasta.
Best regards,
Adam
Adam,
Knowledge doesn't work that way - you don't always get _exactly_ what you're looking for. You get a sense of the direction you should be looking at. Of the many tools that exist to remove duplicates, do you think not even one would address the counting duplicates challenge? Counting duplicates is a much simpler task than removing them, albeit implemented in fewer tools (owing to obvious reasons, including the fact that a
uniq -crun on asedoutput can achieve what you're looking for).I'd recommend taking a look at bioawk, and also being a little less snarky :)
Yes I understand, however your first answer to user 897598644 was as such as
"Hello
I'd like to make cheesecake for my girlfriend. She really loves it. Unfortunately I have no clue how to even start and she will come in next few hours :( " Answer:
"You should search forum with the terms "how to make cheesecake" or you should take a look in cookbook"
So what is the point of this page? In addition to this, sorry but I have bad memories related with awk and anything related to it...
Yes, you start searching forums, or on google, and add your restriction, which is time. So you search "how to make cheesecake in three hours"
Also, hate to make these arguments, but you're not owed an answer by the forum. Plus, you need to understand that neither the cheesecake urgency nor your bad experience with awk is my problem - they're yours to deal with. We give you solutions that work well, and suit the situation well. If you cannot use them owing to inexplicable reasons, we are very sorry, but we cannot always accommodate those.