This is a test version of Biostars. For the public version, visit https://www.biostars.org.
gene transfer format in UCSC download

Excuse me:

The gene transfer format is 1-based, as is introduced in some forums like biostar. But https://genome.ucsc.edu/FAQ/FAQtracks.html said that any database file downloading from UCSC is 0-based.

I was wondering what that format was on earth if I downloaded the file of GTF type from UCSC. Many thanks in advance.

gene genome next-gen-sequencing
• 1,979 views • link
updated by Ram Ram • written by 897598644 897598644

1 answer

While the actual MySQL database uses 0-based coordinates, the files you download that aren't just database dumps (e.g., GTF and BED files) use the coordinates appropriate to them. So, for GTF files you get 1-based coordinates.

• 0 views • link
updated by Ram Ram • written by Devon Ryan Devon Ryan

Log in to answer this question.

More posts like this
  • Converting gtf file from Ensembl to the UCSC Ensembl format (ensGene.txt format)
    written by rahu • rahu
    Hello, I'm using a pipeline that requires UCSC annotation downloaded from: http://hgdownload.cse.ucsc.edu/goldenPath/hg19/database/ensGene.txt.gz I believe this is the format of the ensGene file: https://genome.ucsc.edu/cgi-bin/hgTables?db=danRer10&hgta_group=genes&hgta_track=ensGene&hgta_table=ensGene&hgta_doSchema=describe+table+schema UCSC does …
  • Error in creating the standard Kraken2 database
    written by nathaliaoliveira • nathaliaoliveira
    **Hello I'm trying to create the standard Kraken 2 database, with the following command:** kraken2-build --standard --threads 16 --db kraken-Sdb **I' getting this:** Step 1/2: …
  • GTF file for HTSeq
    written by KVC_bioinfo KVC_bioinfo
    Hello, I have a question regarding the GTF file which is to be used in HTSEQ. can we use the GTF downloaded by genome UCSC …
  • Exon count in ncbi
    written by 897598644 897598644
    Excuse me : There is exon count term in gene item of NCBI. I was wondering why it is not equal to the number of …
  • Ensembl GTF format: isn't the tag "transcript_id" mandatory?
    written by Pfs Pfs
    I just downloaded a GTF file from Ensembl and I noticed that the `transcript_id` tag is missing from some records in the `attributes` field. I …
  • Sample order in vcf
    written by 897598644 897598644
    Excuse me: I used HC (haplotype caller) to call variants to create variant format file. The sample order in HC was not the same as …
  • Bedtools output fasta format files？
    written by 897598644 897598644
    Excuse me: After I got sequences with command: `bedtools/fastaFromBed -fi /ucsc.hg19.fasta -bed /range.bed -fo /range.out.fasta`, the output file is like: ``` >chr2:200172828-200174428 AGTGTCAGTAGTTAAACTCAATT ``` I …
  • genotype calling in gatk
    written by 897598644 897598644
    Excuse me: After calling the genotype with gatk, I manually check the reads covering the variant sites. But I found one exception: The genotype of …
  • variant call format
    written by 897598644 897598644
    Excuse me: In the variant call format v4.1,one example showed the variant result as follows: ref:G, alt: A, NA00001:0|0,NA00002:1|0,NA00003:1/1 Every snp position of variants is …
  • What Does Bed Stand For?
    written by Daniel Standage Daniel Standage
    <p>GFF is for Generic Feature Format, GTF is for Gene transfer format. Is BED (<a href='http://genome.ucsc.edu/FAQ/FAQformat.html#format1'>a la UCSC</a>) also an acronym?</p>